Incidental Mutation 'R7358:Nvl'
ID 571069
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 045444-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7358 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 180962601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 123 (L123P)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000027797
AA Change: L123P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: L123P

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193758
Meta Mutation Damage Score 0.2657 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,510,529 (GRCm39) Q983L probably benign Het
Agtr1a A T 13: 30,564,962 (GRCm39) D9V probably benign Het
Ahcyl T C 16: 45,974,201 (GRCm39) E392G probably damaging Het
Ankrd13c T A 3: 157,697,374 (GRCm39) Y326* probably null Het
Ano2 A G 6: 125,687,696 (GRCm39) D67G probably benign Het
Arhgef5 G A 6: 43,256,507 (GRCm39) R1205H probably damaging Het
Ascc3 T A 10: 50,590,448 (GRCm39) Y1055* probably null Het
Atad5 C T 11: 80,023,862 (GRCm39) A1658V probably benign Het
Atp6ap1l T C 13: 91,031,926 (GRCm39) D252G probably damaging Het
Bdkrb2 T C 12: 105,558,800 (GRCm39) V347A possibly damaging Het
Ccdc187 A T 2: 26,146,007 (GRCm39) L1194Q probably damaging Het
Chd9 A C 8: 91,710,115 (GRCm39) D770A unknown Het
Chd9 A G 8: 91,760,846 (GRCm39) D2197G unknown Het
Clip2 C A 5: 134,531,484 (GRCm39) E774* probably null Het
Clspn A G 4: 126,459,993 (GRCm39) T407A probably benign Het
Col24a1 T A 3: 144,998,926 (GRCm39) probably null Het
Cradd T A 10: 95,158,637 (GRCm39) T37S probably damaging Het
Cspg4b A G 13: 113,456,501 (GRCm39) D849G Het
Ctbp2 A G 7: 132,600,610 (GRCm39) F70S probably damaging Het
D3Ertd751e A T 3: 41,701,000 (GRCm39) E6D probably damaging Het
Dst T A 1: 34,230,754 (GRCm39) F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 (GRCm39) probably null Het
Eif2s1 G T 12: 78,927,969 (GRCm39) G215V probably damaging Het
Epg5 A T 18: 78,002,252 (GRCm39) D557V possibly damaging Het
Eya4 C T 10: 22,999,749 (GRCm39) probably null Het
Fpr1 C A 17: 18,097,242 (GRCm39) R249L probably damaging Het
Fry A G 5: 150,339,788 (GRCm39) T1520A probably benign Het
Gapvd1 C T 2: 34,580,473 (GRCm39) probably null Het
Gemin4 A C 11: 76,104,278 (GRCm39) L161* probably null Het
Gid8 A T 2: 180,359,779 (GRCm39) K221I probably benign Het
Gm21028 A C 7: 42,227,913 (GRCm39) C34G probably damaging Het
Greb1 A G 12: 16,774,882 (GRCm39) S172P probably damaging Het
Herc2 A G 7: 55,832,423 (GRCm39) I3040V possibly damaging Het
Hmcn2 T A 2: 31,306,824 (GRCm39) V3190E probably damaging Het
Hrnr G T 3: 93,230,448 (GRCm39) G229* probably null Het
Igfn1 A T 1: 135,891,738 (GRCm39) V2259D probably damaging Het
Ism2 A G 12: 87,326,814 (GRCm39) F375S probably damaging Het
Kcnk4 T A 19: 6,903,478 (GRCm39) D357V probably damaging Het
Knl1 A G 2: 118,901,040 (GRCm39) R914G possibly damaging Het
Mars2 T C 1: 55,276,729 (GRCm39) S111P probably damaging Het
Mogat2 G A 7: 98,881,673 (GRCm39) P88S possibly damaging Het
Msh2 T A 17: 88,024,957 (GRCm39) S612T possibly damaging Het
Or1j20 T C 2: 36,759,890 (GRCm39) V104A probably benign Het
Or2d3c A T 7: 106,526,111 (GRCm39) L185Q probably damaging Het
Or51v15-ps1 A G 7: 103,278,390 (GRCm39) L259P unknown Het
Or5m11b T A 2: 85,805,780 (GRCm39) S64R possibly damaging Het
Or6c202 T A 10: 128,995,939 (GRCm39) I305F probably benign Het
Or7e174 A T 9: 20,012,169 (GRCm39) Y38F probably damaging Het
P2rx7 A T 5: 122,804,205 (GRCm39) probably null Het
Pard3 A T 8: 128,319,573 (GRCm39) I1149L probably damaging Het
Pcdha8 T A 18: 37,125,830 (GRCm39) I104N probably damaging Het
Pecr G A 1: 72,306,624 (GRCm39) T219I probably benign Het
Pgap2 A T 7: 101,859,774 (GRCm39) probably benign Het
Phf7 T C 14: 30,963,745 (GRCm39) R76G probably benign Het
Pigu T C 2: 155,141,090 (GRCm39) T268A probably damaging Het
Piwil4 T C 9: 14,641,289 (GRCm39) T231A possibly damaging Het
Pkd1l1 T G 11: 8,895,202 (GRCm39) E636A Het
Plscr3 T C 11: 69,738,316 (GRCm39) S55P unknown Het
Pnlip T A 19: 58,664,976 (GRCm39) I268N probably damaging Het
Podxl A T 6: 31,501,929 (GRCm39) H343Q probably benign Het
Prkcd T C 14: 30,327,793 (GRCm39) T213A probably benign Het
Prss22 T A 17: 24,215,419 (GRCm39) Q119L probably benign Het
Psme3ip1 T C 8: 95,302,327 (GRCm39) N235D possibly damaging Het
Ptprcap A G 19: 4,206,238 (GRCm39) E107G possibly damaging Het
Ptprg A G 14: 12,154,198 (GRCm38) T640A possibly damaging Het
Ptprh A T 7: 4,554,006 (GRCm39) probably null Het
Rasa4 A G 5: 136,124,448 (GRCm39) T166A probably benign Het
Sbf2 T C 7: 109,998,555 (GRCm39) E626G possibly damaging Het
Scn2a T A 2: 65,512,850 (GRCm39) Y203* probably null Het
Serpinb1a G C 13: 33,026,981 (GRCm39) H320Q probably damaging Het
Shisa7 G A 7: 4,832,920 (GRCm39) T464I probably benign Het
Slc47a2 G A 11: 61,199,699 (GRCm39) A399V possibly damaging Het
Snrnp200 A G 2: 127,063,746 (GRCm39) T642A probably benign Het
Spag16 A G 1: 69,883,526 (GRCm39) H85R probably benign Het
Spata31h1 A G 10: 82,127,847 (GRCm39) L1721S possibly damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stag3 C A 5: 138,299,770 (GRCm39) L894M probably damaging Het
Sun2 A T 15: 79,618,313 (GRCm39) F284Y probably benign Het
Tpx2 T A 2: 152,718,550 (GRCm39) N184K probably benign Het
Trpa1 A T 1: 14,968,334 (GRCm39) N477K probably damaging Het
Ttbk2 C T 2: 120,620,791 (GRCm39) R157H probably damaging Het
Ttn C T 2: 76,537,649 (GRCm39) E34760K probably benign Het
Tysnd1 T C 10: 61,532,427 (GRCm39) S360P probably damaging Het
Uqcc5 A G 14: 30,846,560 (GRCm39) V53A probably damaging Het
Usp34 T A 11: 23,311,683 (GRCm39) L511I probably damaging Het
Vmn2r71 A T 7: 85,273,468 (GRCm39) T761S possibly damaging Het
Zdhhc18 G T 4: 133,360,482 (GRCm39) C73* probably null Het
Zfp975 A T 7: 42,312,215 (GRCm39) C133S probably damaging Het
Zfy1 T C Y: 735,141 (GRCm39) E214G unknown Het
Zmym5 T A 14: 57,031,597 (GRCm39) K504* probably null Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R7931:Nvl UTSW 1 180,936,720 (GRCm39) splice site probably benign
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTCCACCGGGAGTTTTGTC -3'
(R):5'- CATGGTTCTCTGTTAGCCAAGAG -3'

Sequencing Primer
(F):5'- CCGGGAGTTTTGTCAATAAACCATCC -3'
(R):5'- CCAAGAGTGGTTTAGTAGTTTCAG -3'
Posted On 2019-09-13