Incidental Mutation 'R7358:Scn2a'
ID 571074
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7358 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65620771-65767447 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 65682506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 203 (Y203*)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably null
Transcript: ENSMUST00000028377
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: Y203*

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100067
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: Y203*

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144254
SMART Domains Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 7.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
low complexity region 484 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7491:Scn2a UTSW 2 65702008 missense probably damaging 0.99
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
R8897:Scn2a UTSW 2 65715658 critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65763670 missense probably damaging 0.99
R8992:Scn2a UTSW 2 65763898 missense probably damaging 1.00
R9190:Scn2a UTSW 2 65681002 missense probably benign 0.00
R9206:Scn2a UTSW 2 65717787 missense probably damaging 1.00
R9355:Scn2a UTSW 2 65764089 missense probably damaging 1.00
R9452:Scn2a UTSW 2 65764819 missense probably benign
R9529:Scn2a UTSW 2 65764588 missense probably damaging 0.99
R9567:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R9569:Scn2a UTSW 2 65730278 missense probably damaging 1.00
R9657:Scn2a UTSW 2 65735688 missense probably damaging 1.00
R9715:Scn2a UTSW 2 65748805 missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65735686 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTCTGGAGAAATTAGGAATGATCC -3'
(R):5'- TCTGTAATAGGGAGTCCACACAC -3'

Sequencing Primer
(F):5'- ATATGGTGTTGGTTTCGATTAGC -3'
(R):5'- GTAATAGGGAGTCCACACACAAACAC -3'
Posted On 2019-09-13