Incidental Mutation 'R7358:Hrnr'
ID571084
Institutional Source Beutler Lab
Gene Symbol Hrnr
Ensembl Gene ENSMUSG00000041991
Gene Namehornerin
Synonyms1110033K19Rik, S100a18, A530063N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location93319749-93333570 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 93323141 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 229 (G229*)
Ref Sequence ENSEMBL: ENSMUSP00000091288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090856] [ENSMUST00000093774]
Predicted Effect probably null
Transcript: ENSMUST00000090856
AA Change: G229*
SMART Domains Protein: ENSMUSP00000088369
Gene: ENSMUSG00000041991
AA Change: G229*

DomainStartEndE-ValueType
Pfam:S_100 4 47 4.8e-15 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 7.19e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 5.7e-19 PROSPERO
internal_repeat_1 291 354 5.27e-23 PROSPERO
internal_repeat_3 301 355 9.03e-17 PROSPERO
internal_repeat_5 309 343 7.19e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2413 2447 N/A INTRINSIC
low complexity region 2457 2498 N/A INTRINSIC
low complexity region 2503 2580 N/A INTRINSIC
low complexity region 2583 2605 N/A INTRINSIC
low complexity region 2609 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2761 2795 N/A INTRINSIC
low complexity region 2805 2846 N/A INTRINSIC
low complexity region 2851 2896 N/A INTRINSIC
internal_repeat_4 2897 2968 4.19e-13 PROSPERO
internal_repeat_3 2901 2955 9.03e-17 PROSPERO
internal_repeat_2 2920 2967 5.7e-19 PROSPERO
low complexity region 2969 2985 N/A INTRINSIC
low complexity region 3016 3034 N/A INTRINSIC
internal_repeat_1 3039 3101 5.27e-23 PROSPERO
internal_repeat_4 3045 3103 4.19e-13 PROSPERO
low complexity region 3140 3153 N/A INTRINSIC
low complexity region 3163 3174 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093774
AA Change: G229*
SMART Domains Protein: ENSMUSP00000091288
Gene: ENSMUSG00000041991
AA Change: G229*

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.1e-17 PFAM
Blast:EFh 53 81 6e-9 BLAST
internal_repeat_5 95 129 5.9e-7 PROSPERO
low complexity region 135 155 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
low complexity region 200 246 N/A INTRINSIC
low complexity region 255 287 N/A INTRINSIC
internal_repeat_2 288 341 3.49e-19 PROSPERO
internal_repeat_1 291 354 2.93e-23 PROSPERO
internal_repeat_3 301 355 5.83e-17 PROSPERO
internal_repeat_5 309 343 5.9e-7 PROSPERO
low complexity region 358 379 N/A INTRINSIC
low complexity region 394 415 N/A INTRINSIC
low complexity region 421 498 N/A INTRINSIC
low complexity region 501 523 N/A INTRINSIC
low complexity region 527 593 N/A INTRINSIC
low complexity region 598 675 N/A INTRINSIC
low complexity region 679 713 N/A INTRINSIC
low complexity region 723 764 N/A INTRINSIC
low complexity region 769 846 N/A INTRINSIC
low complexity region 849 871 N/A INTRINSIC
low complexity region 875 941 N/A INTRINSIC
low complexity region 946 1023 N/A INTRINSIC
low complexity region 1027 1061 N/A INTRINSIC
low complexity region 1084 1112 N/A INTRINSIC
low complexity region 1117 1194 N/A INTRINSIC
low complexity region 1197 1219 N/A INTRINSIC
low complexity region 1223 1289 N/A INTRINSIC
low complexity region 1294 1371 N/A INTRINSIC
low complexity region 1375 1409 N/A INTRINSIC
low complexity region 1419 1460 N/A INTRINSIC
low complexity region 1465 1542 N/A INTRINSIC
low complexity region 1545 1567 N/A INTRINSIC
low complexity region 1571 1637 N/A INTRINSIC
low complexity region 1642 1719 N/A INTRINSIC
low complexity region 1723 1757 N/A INTRINSIC
low complexity region 1767 1808 N/A INTRINSIC
low complexity region 1813 1890 N/A INTRINSIC
low complexity region 1893 1915 N/A INTRINSIC
low complexity region 1919 1985 N/A INTRINSIC
low complexity region 1990 2067 N/A INTRINSIC
low complexity region 2071 2105 N/A INTRINSIC
low complexity region 2115 2156 N/A INTRINSIC
low complexity region 2161 2238 N/A INTRINSIC
low complexity region 2242 2276 N/A INTRINSIC
low complexity region 2286 2327 N/A INTRINSIC
low complexity region 2332 2409 N/A INTRINSIC
low complexity region 2412 2434 N/A INTRINSIC
low complexity region 2438 2504 N/A INTRINSIC
low complexity region 2509 2586 N/A INTRINSIC
low complexity region 2590 2624 N/A INTRINSIC
low complexity region 2634 2675 N/A INTRINSIC
low complexity region 2680 2757 N/A INTRINSIC
low complexity region 2760 2782 N/A INTRINSIC
low complexity region 2786 2852 N/A INTRINSIC
low complexity region 2857 2934 N/A INTRINSIC
low complexity region 2938 2972 N/A INTRINSIC
low complexity region 2982 3023 N/A INTRINSIC
low complexity region 3028 3073 N/A INTRINSIC
internal_repeat_4 3074 3145 2.96e-13 PROSPERO
internal_repeat_3 3078 3132 5.83e-17 PROSPERO
internal_repeat_2 3097 3144 3.49e-19 PROSPERO
low complexity region 3146 3162 N/A INTRINSIC
low complexity region 3193 3211 N/A INTRINSIC
internal_repeat_1 3216 3278 2.93e-23 PROSPERO
internal_repeat_4 3222 3280 2.96e-13 PROSPERO
low complexity region 3317 3330 N/A INTRINSIC
low complexity region 3340 3351 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Hrnr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Hrnr APN 3 93322897 missense unknown
IGL02326:Hrnr APN 3 93323745 missense unknown
IGL03030:Hrnr APN 3 93320601 missense possibly damaging 0.91
IGL03281:Hrnr APN 3 93322851 missense probably benign 0.04
R0140:Hrnr UTSW 3 93331493 nonsense probably null
R0709:Hrnr UTSW 3 93332508 missense unknown
R1179:Hrnr UTSW 3 93332543 missense unknown
R1528:Hrnr UTSW 3 93322794 missense possibly damaging 0.56
R1640:Hrnr UTSW 3 93332516 missense unknown
R1987:Hrnr UTSW 3 93332604 missense unknown
R1988:Hrnr UTSW 3 93332604 missense unknown
R3846:Hrnr UTSW 3 93332157 missense unknown
R3871:Hrnr UTSW 3 93331874 missense unknown
R3938:Hrnr UTSW 3 93322855 missense probably benign 0.35
R4569:Hrnr UTSW 3 93323568 missense unknown
R4690:Hrnr UTSW 3 93323652 missense unknown
R4761:Hrnr UTSW 3 93322755 missense probably damaging 0.96
R5182:Hrnr UTSW 3 93332143 missense unknown
R5292:Hrnr UTSW 3 93331892 missense unknown
R5739:Hrnr UTSW 3 93323129 missense unknown
R5845:Hrnr UTSW 3 93332637 missense unknown
R5994:Hrnr UTSW 3 93332300 missense unknown
R6169:Hrnr UTSW 3 93325755 nonsense probably null
R6216:Hrnr UTSW 3 93332162 missense unknown
R6256:Hrnr UTSW 3 93322611 missense probably damaging 1.00
R6670:Hrnr UTSW 3 93331885 missense unknown
R6790:Hrnr UTSW 3 93329075 missense unknown
R6936:Hrnr UTSW 3 93332360 missense unknown
R7049:Hrnr UTSW 3 93323154 nonsense probably null
R7383:Hrnr UTSW 3 93331791 missense unknown
R7724:Hrnr UTSW 3 93323016 missense unknown
R7762:Hrnr UTSW 3 93332199 missense unknown
R7945:Hrnr UTSW 3 93332199 missense unknown
R8086:Hrnr UTSW 3 93323421 missense unknown
R8115:Hrnr UTSW 3 93323732 missense unknown
R8383:Hrnr UTSW 3 93332346 missense unknown
R8685:Hrnr UTSW 3 93322898 missense unknown
R8809:Hrnr UTSW 3 93332136 missense unknown
Predicted Primers PCR Primer
(F):5'- TTATTCCAGGGGCTCAAGAGG -3'
(R):5'- CCAGGTTCTTCTGATGATCCAGAG -3'

Sequencing Primer
(F):5'- ACAAAATCAAATTCAAGTGATCACG -3'
(R):5'- ATCCAGAGCTATATTCTTGGGAGCC -3'
Posted On2019-09-13