Mutagenetix > Incidental Mutation

Incidental Mutation 'R7358:Clip2'

571090

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

WSCR4, Cyln2, CLIP-115

MMRRC Submission

045444-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.203) question?

Stock #

R7358 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

134489383-134552434 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 134502630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 774 (E774*)

Ref Sequence

ENSEMBL: ENSMUSP00000098212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

AlphaFold

Q9Z0H8

Predicted Effect

probably null
Transcript: ENSMUST00000036999
AA Change: E739*

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: E739*

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000100647
AA Change: E774*

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: E774*

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,292,013	L1721S	possibly damaging	Het
Abca17	T	A	17: 24,291,555	Q983L	probably benign	Het
Agtr1a	A	T	13: 30,380,979	D9V	probably benign	Het
Ankrd13c	T	A	3: 157,991,737	Y326*	probably null	Het
Ano2	A	G	6: 125,710,733	D67G	probably benign	Het
Arhgef5	G	A	6: 43,279,573	R1205H	probably damaging	Het
Ascc3	T	A	10: 50,714,352	Y1055*	probably null	Het
Atad5	C	T	11: 80,133,036	A1658V	probably benign	Het
Atp6ap1l	T	C	13: 90,883,807	D252G	probably damaging	Het
BC067074	A	G	13: 113,319,967	D849G		Het
Bdkrb2	T	C	12: 105,592,541	V347A	possibly damaging	Het
Ccdc187	A	T	2: 26,255,995	L1194Q	probably damaging	Het
Chd9	A	C	8: 90,983,487	D770A	unknown	Het
Chd9	A	G	8: 91,034,218	D2197G	unknown	Het
Clspn	A	G	4: 126,566,200	T407A	probably benign	Het
Col24a1	T	A	3: 145,293,165		probably null	Het
Cradd	T	A	10: 95,322,775	T37S	probably damaging	Het
Ctbp2	A	G	7: 132,998,881	F70S	probably damaging	Het
D3Ertd751e	A	T	3: 41,746,565	E6D	probably damaging	Het
Dst	T	A	1: 34,191,673	F2782L	probably benign	Het
Dync2h1	A	G	9: 7,159,479		probably null	Het
Eif2s1	G	T	12: 78,881,195	G215V	probably damaging	Het
Epg5	A	T	18: 77,959,037	D557V	possibly damaging	Het
Eya4	C	T	10: 23,123,851		probably null	Het
Fam192a	T	C	8: 94,575,699	N235D	possibly damaging	Het
Fpr1	C	A	17: 17,876,980	R249L	probably damaging	Het
Fry	A	G	5: 150,416,323	T1520A	probably benign	Het
Gapvd1	C	T	2: 34,690,461		probably null	Het
Gemin4	A	C	11: 76,213,452	L161*	probably null	Het
Gid8	A	T	2: 180,717,986	K221I	probably benign	Het
Gm21028	A	C	7: 42,578,489	C34G	probably damaging	Het
Gm4737	T	C	16: 46,153,838	E392G	probably damaging	Het
Greb1	A	G	12: 16,724,881	S172P	probably damaging	Het
Herc2	A	G	7: 56,182,675	I3040V	possibly damaging	Het
Hmcn2	T	A	2: 31,416,812	V3190E	probably damaging	Het
Hrnr	G	T	3: 93,323,141	G229*	probably null	Het
Igfn1	A	T	1: 135,964,000	V2259D	probably damaging	Het
Ism2	A	G	12: 87,280,040	F375S	probably damaging	Het
Kcnk4	T	A	19: 6,926,110	D357V	probably damaging	Het
Knl1	A	G	2: 119,070,559	R914G	possibly damaging	Het
Mars2	T	C	1: 55,237,570	S111P	probably damaging	Het
Mogat2	G	A	7: 99,232,466	P88S	possibly damaging	Het
Msh2	T	A	17: 87,717,529	S612T	possibly damaging	Het
Nvl	A	G	1: 181,135,036	L123P	probably damaging	Het
Olfr1029	T	A	2: 85,975,436	S64R	possibly damaging	Het
Olfr352	T	C	2: 36,869,878	V104A	probably benign	Het
Olfr621-ps1	A	G	7: 103,629,183	L259P	unknown	Het
Olfr709-ps1	A	T	7: 106,926,904	L185Q	probably damaging	Het
Olfr771	T	A	10: 129,160,070	I305F	probably benign	Het
Olfr868	A	T	9: 20,100,873	Y38F	probably damaging	Het
P2rx7	A	T	5: 122,666,142		probably null	Het
Pard3	A	T	8: 127,593,092	I1149L	probably damaging	Het
Pcdha8	T	A	18: 36,992,777	I104N	probably damaging	Het
Pecr	G	A	1: 72,267,465	T219I	probably benign	Het
Pgap2	A	T	7: 102,210,567		probably benign	Het
Phf7	T	C	14: 31,241,788	R76G	probably benign	Het
Pigu	T	C	2: 155,299,170	T268A	probably damaging	Het
Piwil4	T	C	9: 14,729,993	T231A	possibly damaging	Het
Pkd1l1	T	G	11: 8,945,202	E636A		Het
Plscr3	T	C	11: 69,847,490	S55P	unknown	Het
Pnlip	T	A	19: 58,676,544	I268N	probably damaging	Het
Podxl	A	T	6: 31,524,994	H343Q	probably benign	Het
Prkcd	T	C	14: 30,605,836	T213A	probably benign	Het
Prss22	T	A	17: 23,996,445	Q119L	probably benign	Het
Ptprcap	A	G	19: 4,156,239	E107G	possibly damaging	Het
Ptprg	A	G	14: 12,154,198	T640A	possibly damaging	Het
Ptprh	A	T	7: 4,551,007		probably null	Het
Rasa4	A	G	5: 136,095,594	T166A	probably benign	Het
Sbf2	T	C	7: 110,399,348	E626G	possibly damaging	Het
Scn2a	T	A	2: 65,682,506	Y203*	probably null	Het
Serpinb1a	G	C	13: 32,842,998	H320Q	probably damaging	Het
Shisa7	G	A	7: 4,829,921	T464I	probably benign	Het
Slc47a2	G	A	11: 61,308,873	A399V	possibly damaging	Het
Smim4	A	G	14: 31,124,603	V53A	probably damaging	Het
Snrnp200	A	G	2: 127,221,826	T642A	probably benign	Het
Spag16	A	G	1: 69,844,367	H85R	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stag3	C	A	5: 138,301,508	L894M	probably damaging	Het
Sun2	A	T	15: 79,734,112	F284Y	probably benign	Het
Tpx2	T	A	2: 152,876,630	N184K	probably benign	Het
Trpa1	A	T	1: 14,898,110	N477K	probably damaging	Het
Ttbk2	C	T	2: 120,790,310	R157H	probably damaging	Het
Ttn	C	T	2: 76,707,305	E34760K	probably benign	Het
Tysnd1	T	C	10: 61,696,648	S360P	probably damaging	Het
Usp34	T	A	11: 23,361,683	L511I	probably damaging	Het
Vmn2r71	A	T	7: 85,624,260	T761S	possibly damaging	Het
Zdhhc18	G	T	4: 133,633,171	C73*	probably null	Het
Zfp975	A	T	7: 42,662,791	C133S	probably damaging	Het
Zfy1	T	C	Y: 735,141	E214G	unknown	Het
Zmym5	T	A	14: 56,794,140	K504*	probably null	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134500157	splice site	probably benign
IGL01024:Clip2	APN	5	134510212	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134492350	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134522664	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134498084	splice site	probably benign
IGL02174:Clip2	APN	5	134494264	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134503130	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134502571	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134518022	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134510159	splice site	probably benign
IGL03198:Clip2	APN	5	134498082	splice site	probably benign
IGL03269:Clip2	APN	5	134516894	missense	probably damaging	1.00
scissors	UTSW	5	134517999	nonsense	probably null
R0335:Clip2	UTSW	5	134535215	start gained	probably benign
R0422:Clip2	UTSW	5	134498113	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134516151	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134492250	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134503253	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134502929	nonsense	probably null
R1822:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134503115	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134523064	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134492253	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134535197	start gained	probably benign
R4239:Clip2	UTSW	5	134535197	start gained	probably benign
R4294:Clip2	UTSW	5	134492313	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134502953	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134516269	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134514048	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134502779	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134491925	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134522630	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134496241	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134502917	missense	probably benign	0.01
R7725:Clip2	UTSW	5	134517999	nonsense	probably null
R8380:Clip2	UTSW	5	134502797	missense	probably damaging	0.96
R8680:Clip2	UTSW	5	134502608	missense	probably benign
R9095:Clip2	UTSW	5	134503400	missense	possibly damaging	0.93
R9158:Clip2	UTSW	5	134492397	missense	probably benign	0.00
R9277:Clip2	UTSW	5	134500109	missense	probably benign
R9300:Clip2	UTSW	5	134498088	critical splice donor site	probably null
R9457:Clip2	UTSW	5	134502730	missense	probably benign	0.00
R9491:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9605:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9630:Clip2	UTSW	5	134503080	missense	probably damaging	1.00
R9657:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9660:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9661:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9662:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9663:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9730:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9731:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9732:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9773:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9787:Clip2	UTSW	5	134504762	missense	probably benign	0.04
R9788:Clip2	UTSW	5	134504762	missense	probably benign	0.04
X0062:Clip2	UTSW	5	134503136	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134516835	missense	probably damaging	0.98
Z1177:Clip2	UTSW	5	134522999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAATGCTCTGGAACTGGCG -3'
(R):5'- GTTAGGTAACCTGCAGGCCAAG -3'

Sequencing Primer
(F):5'- GAACTGGCGCGCAGAGG -3'
(R):5'- TTGGAGACGGCCATGCATG -3'

Posted On

2019-09-13