Mutagenetix > Incidental Mutation

Incidental Mutation 'R7358:Arhgef5'

571095

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7358 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43279573 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1205 (R1205H)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: R1205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: R1205H

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	A	G	10: 82,292,013	L1721S	possibly damaging	Het
Abca17	T	A	17: 24,291,555	Q983L	probably benign	Het
Agtr1a	A	T	13: 30,380,979	D9V	probably benign	Het
Ankrd13c	T	A	3: 157,991,737	Y326*	probably null	Het
Ano2	A	G	6: 125,710,733	D67G	probably benign	Het
Ascc3	T	A	10: 50,714,352	Y1055*	probably null	Het
Atad5	C	T	11: 80,133,036	A1658V	probably benign	Het
Atp6ap1l	T	C	13: 90,883,807	D252G	probably damaging	Het
BC067074	A	G	13: 113,319,967	D849G		Het
Bdkrb2	T	C	12: 105,592,541	V347A	possibly damaging	Het
Ccdc187	A	T	2: 26,255,995	L1194Q	probably damaging	Het
Chd9	A	C	8: 90,983,487	D770A	unknown	Het
Chd9	A	G	8: 91,034,218	D2197G	unknown	Het
Clip2	C	A	5: 134,502,630	E774*	probably null	Het
Clspn	A	G	4: 126,566,200	T407A	probably benign	Het
Col24a1	T	A	3: 145,293,165		probably null	Het
Cradd	T	A	10: 95,322,775	T37S	probably damaging	Het
Ctbp2	A	G	7: 132,998,881	F70S	probably damaging	Het
D3Ertd751e	A	T	3: 41,746,565	E6D	probably damaging	Het
Dst	T	A	1: 34,191,673	F2782L	probably benign	Het
Dync2h1	A	G	9: 7,159,479		probably null	Het
Eif2s1	G	T	12: 78,881,195	G215V	probably damaging	Het
Epg5	A	T	18: 77,959,037	D557V	possibly damaging	Het
Eya4	C	T	10: 23,123,851		probably null	Het
Fam192a	T	C	8: 94,575,699	N235D	possibly damaging	Het
Fpr1	C	A	17: 17,876,980	R249L	probably damaging	Het
Fry	A	G	5: 150,416,323	T1520A	probably benign	Het
Gapvd1	C	T	2: 34,690,461		probably null	Het
Gemin4	A	C	11: 76,213,452	L161*	probably null	Het
Gid8	A	T	2: 180,717,986	K221I	probably benign	Het
Gm21028	A	C	7: 42,578,489	C34G	probably damaging	Het
Gm4737	T	C	16: 46,153,838	E392G	probably damaging	Het
Greb1	A	G	12: 16,724,881	S172P	probably damaging	Het
Herc2	A	G	7: 56,182,675	I3040V	possibly damaging	Het
Hmcn2	T	A	2: 31,416,812	V3190E	probably damaging	Het
Hrnr	G	T	3: 93,323,141	G229*	probably null	Het
Igfn1	A	T	1: 135,964,000	V2259D	probably damaging	Het
Ism2	A	G	12: 87,280,040	F375S	probably damaging	Het
Kcnk4	T	A	19: 6,926,110	D357V	probably damaging	Het
Knl1	A	G	2: 119,070,559	R914G	possibly damaging	Het
Mars2	T	C	1: 55,237,570	S111P	probably damaging	Het
Mogat2	G	A	7: 99,232,466	P88S	possibly damaging	Het
Msh2	T	A	17: 87,717,529	S612T	possibly damaging	Het
Nvl	A	G	1: 181,135,036	L123P	probably damaging	Het
Olfr1029	T	A	2: 85,975,436	S64R	possibly damaging	Het
Olfr352	T	C	2: 36,869,878	V104A	probably benign	Het
Olfr621-ps1	A	G	7: 103,629,183	L259P	unknown	Het
Olfr709-ps1	A	T	7: 106,926,904	L185Q	probably damaging	Het
Olfr771	T	A	10: 129,160,070	I305F	probably benign	Het
Olfr868	A	T	9: 20,100,873	Y38F	probably damaging	Het
P2rx7	A	T	5: 122,666,142		probably null	Het
Pard3	A	T	8: 127,593,092	I1149L	probably damaging	Het
Pcdha8	T	A	18: 36,992,777	I104N	probably damaging	Het
Pecr	G	A	1: 72,267,465	T219I	probably benign	Het
Pgap2	A	T	7: 102,210,567		probably benign	Het
Phf7	T	C	14: 31,241,788	R76G	probably benign	Het
Pigu	T	C	2: 155,299,170	T268A	probably damaging	Het
Piwil4	T	C	9: 14,729,993	T231A	possibly damaging	Het
Pkd1l1	T	G	11: 8,945,202	E636A		Het
Plscr3	T	C	11: 69,847,490	S55P	unknown	Het
Pnlip	T	A	19: 58,676,544	I268N	probably damaging	Het
Podxl	A	T	6: 31,524,994	H343Q	probably benign	Het
Prkcd	T	C	14: 30,605,836	T213A	probably benign	Het
Prss22	T	A	17: 23,996,445	Q119L	probably benign	Het
Ptprcap	A	G	19: 4,156,239	E107G	possibly damaging	Het
Ptprg	A	G	14: 12,154,198	T640A	possibly damaging	Het
Ptprh	A	T	7: 4,551,007		probably null	Het
Rasa4	A	G	5: 136,095,594	T166A	probably benign	Het
Sbf2	T	C	7: 110,399,348	E626G	possibly damaging	Het
Scn2a	T	A	2: 65,682,506	Y203*	probably null	Het
Serpinb1a	G	C	13: 32,842,998	H320Q	probably damaging	Het
Shisa7	G	A	7: 4,829,921	T464I	probably benign	Het
Slc47a2	G	A	11: 61,308,873	A399V	possibly damaging	Het
Smim4	A	G	14: 31,124,603	V53A	probably damaging	Het
Snrnp200	A	G	2: 127,221,826	T642A	probably benign	Het
Spag16	A	G	1: 69,844,367	H85R	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stag3	C	A	5: 138,301,508	L894M	probably damaging	Het
Sun2	A	T	15: 79,734,112	F284Y	probably benign	Het
Tpx2	T	A	2: 152,876,630	N184K	probably benign	Het
Trpa1	A	T	1: 14,898,110	N477K	probably damaging	Het
Ttbk2	C	T	2: 120,790,310	R157H	probably damaging	Het
Ttn	C	T	2: 76,707,305	E34760K	probably benign	Het
Tysnd1	T	C	10: 61,696,648	S360P	probably damaging	Het
Usp34	T	A	11: 23,361,683	L511I	probably damaging	Het
Vmn2r71	A	T	7: 85,624,260	T761S	possibly damaging	Het
Zdhhc18	G	T	4: 133,633,171	C73*	probably null	Het
Zfp975	A	T	7: 42,662,791	C133S	probably damaging	Het
Zfy1	T	C	Y: 735,141	E214G	unknown	Het
Zmym5	T	A	14: 56,794,140	K504*	probably null	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GATCAACCCTAAACCATTGTTCAGC -3'
(R):5'- TCTACCCCTGAAGGTCATGGAG -3'

Sequencing Primer
(F):5'- TCAGCAACTTTTATCTACCAGACAG -3'
(R):5'- TCATGGAGGGAGCCCAG -3'

Posted On

2019-09-13