Incidental Mutation 'R7358:Ascc3'
ID571117
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50714352 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1055 (Y1055*)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably null
Transcript: ENSMUST00000035606
AA Change: Y1055*
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: Y1055*

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1840:Ascc3 UTSW 10 50690161 missense probably benign 0.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
R7538:Ascc3 UTSW 10 50845700 missense probably damaging 1.00
R7838:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R7921:Ascc3 UTSW 10 50728297 missense probably benign 0.04
R8021:Ascc3 UTSW 10 50731648 missense probably benign 0.02
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Z1177:Ascc3 UTSW 10 50718421 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATCAACTGAAGGATGATAAGGTC -3'
(R):5'- CTGGCAGCATTCTCAGTGTG -3'

Sequencing Primer
(F):5'- TTTACAACTACCTGTGTGCAAAG -3'
(R):5'- CAGCATTCTCAGTGTGACATG -3'
Posted On2019-09-13