Incidental Mutation 'R7358:Usp34'
ID571123
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Nameubiquitin specific peptidase 34
SynonymsMurr2, A530081C03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location23306895-23490560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23361683 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 511 (L511I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
Predicted Effect probably damaging
Transcript: ENSMUST00000137823
AA Change: L511I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: L511I

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180046
AA Change: L492I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: L492I

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Agtr1a A T 13: 30,380,979 D9V probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL00477:Usp34 APN 11 23468879 missense probably damaging 0.99
IGL01307:Usp34 APN 11 23417676 missense probably damaging 0.99
IGL01313:Usp34 APN 11 23473206 missense probably damaging 1.00
IGL01794:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01826:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01827:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01830:Usp34 APN 11 23436020 missense probably damaging 0.98
IGL01867:Usp34 APN 11 23384411 missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23345141 splice site probably benign
IGL01977:Usp34 APN 11 23452661 missense probably damaging 1.00
IGL01985:Usp34 APN 11 23452565 missense probably damaging 1.00
IGL02011:Usp34 APN 11 23471554 missense probably damaging 0.99
IGL02302:Usp34 APN 11 23467243 missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23354900 missense probably benign 0.11
IGL02491:Usp34 APN 11 23432630 missense probably damaging 0.98
IGL02532:Usp34 APN 11 23370291 missense probably damaging 0.99
IGL02561:Usp34 APN 11 23351652 missense probably benign 0.09
IGL02706:Usp34 APN 11 23388659 splice site probably benign
IGL02891:Usp34 APN 11 23487166 missense probably benign 0.09
IGL03079:Usp34 APN 11 23432247 missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23446958 missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23488686 missense probably benign
IGL03256:Usp34 APN 11 23420090 nonsense probably null
IGL03280:Usp34 APN 11 23354897 missense probably damaging 1.00
IGL03289:Usp34 APN 11 23393818 missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23446957 missense possibly damaging 0.92
Chub UTSW 11 23464686 missense probably damaging 0.99
Cicione UTSW 11 23489033 missense possibly damaging 0.85
I2288:Usp34 UTSW 11 23432473 splice site probably benign
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0047:Usp34 UTSW 11 23464403 missense probably benign 0.34
R0099:Usp34 UTSW 11 23363111 missense probably damaging 1.00
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0240:Usp34 UTSW 11 23433206 missense probably damaging 0.99
R0403:Usp34 UTSW 11 23333838 missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23401505 missense probably damaging 0.99
R0446:Usp34 UTSW 11 23467207 missense probably damaging 0.97
R0455:Usp34 UTSW 11 23446741 splice site probably benign
R0470:Usp34 UTSW 11 23436001 missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23384509 splice site probably benign
R0512:Usp34 UTSW 11 23451997 missense probably benign 0.04
R0557:Usp34 UTSW 11 23403848 missense probably damaging 0.98
R0562:Usp34 UTSW 11 23432406 splice site probably benign
R0656:Usp34 UTSW 11 23472967 missense probably damaging 0.99
R0693:Usp34 UTSW 11 23452637 missense probably damaging 0.97
R0739:Usp34 UTSW 11 23467243 missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23384420 missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23433175 splice site probably benign
R1223:Usp34 UTSW 11 23446464 synonymous probably null
R1295:Usp34 UTSW 11 23384477 missense probably damaging 1.00
R1430:Usp34 UTSW 11 23459151 missense probably damaging 0.97
R1445:Usp34 UTSW 11 23351629 missense probably damaging 0.99
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1468:Usp34 UTSW 11 23441171 missense probably damaging 1.00
R1471:Usp34 UTSW 11 23488862 missense probably benign 0.20
R1475:Usp34 UTSW 11 23473253 missense probably damaging 0.99
R1628:Usp34 UTSW 11 23488725 missense probably damaging 1.00
R1631:Usp34 UTSW 11 23460651 missense probably damaging 0.99
R1655:Usp34 UTSW 11 23375051 missense probably benign 0.05
R1741:Usp34 UTSW 11 23364103 missense probably benign 0.00
R1854:Usp34 UTSW 11 23426153 missense probably benign 0.24
R1867:Usp34 UTSW 11 23361593 missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1870:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1871:Usp34 UTSW 11 23364479 missense probably benign 0.37
R1967:Usp34 UTSW 11 23364503 missense probably benign 0.01
R2051:Usp34 UTSW 11 23464468 missense probably damaging 0.97
R2132:Usp34 UTSW 11 23464556 missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23382602 missense probably damaging 0.98
R2205:Usp34 UTSW 11 23385147 missense probably damaging 0.97
R2342:Usp34 UTSW 11 23403599 missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23370466 missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23464517 missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23343640 missense probably benign 0.28
R3972:Usp34 UTSW 11 23457803 missense probably damaging 1.00
R4018:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23489033 missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23417676 missense probably damaging 0.99
R4197:Usp34 UTSW 11 23444189 missense probably damaging 0.98
R4352:Usp34 UTSW 11 23320727 missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23384499 missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23435998 missense probably damaging 0.98
R4475:Usp34 UTSW 11 23457975 missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23401529 missense probably damaging 1.00
R4527:Usp34 UTSW 11 23421257 missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23464633 missense probably damaging 0.97
R4612:Usp34 UTSW 11 23432268 missense probably damaging 0.99
R4673:Usp34 UTSW 11 23364480 small deletion probably benign
R4707:Usp34 UTSW 11 23487215 missense probably damaging 1.00
R4736:Usp34 UTSW 11 23393749 splice site probably null
R4867:Usp34 UTSW 11 23451999 missense probably benign 0.28
R4879:Usp34 UTSW 11 23373410 missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23488982 missense probably damaging 1.00
R5004:Usp34 UTSW 11 23464586 missense probably damaging 1.00
R5057:Usp34 UTSW 11 23458086 intron probably benign
R5068:Usp34 UTSW 11 23460665 missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23343616 missense probably damaging 1.00
R5320:Usp34 UTSW 11 23333739 missense probably benign
R5327:Usp34 UTSW 11 23468846 missense probably damaging 1.00
R5328:Usp34 UTSW 11 23464616 missense probably benign 0.01
R5328:Usp34 UTSW 11 23488659 missense probably benign 0.04
R5390:Usp34 UTSW 11 23444202 critical splice donor site probably null
R5434:Usp34 UTSW 11 23412271 missense probably damaging 0.99
R5523:Usp34 UTSW 11 23349198 missense probably benign 0.39
R5567:Usp34 UTSW 11 23488336 missense probably damaging 0.97
R5571:Usp34 UTSW 11 23457975 missense probably damaging 0.99
R5645:Usp34 UTSW 11 23375024 missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23343515 missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23354846 missense probably benign 0.00
R5813:Usp34 UTSW 11 23421340 missense probably benign 0.38
R5921:Usp34 UTSW 11 23464686 missense probably damaging 0.99
R5928:Usp34 UTSW 11 23436040 missense probably damaging 0.98
R5944:Usp34 UTSW 11 23363089 missense probably damaging 1.00
R6198:Usp34 UTSW 11 23484127 missense probably damaging 1.00
R6229:Usp34 UTSW 11 23446778 missense probably damaging 0.99
R6306:Usp34 UTSW 11 23412260 missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23452520 missense probably damaging 0.98
R6341:Usp34 UTSW 11 23381353 missense probably damaging 0.97
R6374:Usp34 UTSW 11 23438914 missense probably damaging 1.00
R6398:Usp34 UTSW 11 23488666 missense probably benign
R6438:Usp34 UTSW 11 23364266 missense probably benign 0.02
R6668:Usp34 UTSW 11 23460659 missense probably damaging 0.97
R6700:Usp34 UTSW 11 23439011 missense probably damaging 1.00
R6783:Usp34 UTSW 11 23412318 missense probably damaging 1.00
R6821:Usp34 UTSW 11 23367491 missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23452569 missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23458023 missense probably damaging 0.98
R7020:Usp34 UTSW 11 23393954 missense probably benign 0.05
R7026:Usp34 UTSW 11 23361622 missense probably damaging 1.00
R7085:Usp34 UTSW 11 23363097 missense
R7101:Usp34 UTSW 11 23426183 missense
R7168:Usp34 UTSW 11 23464585 missense
R7192:Usp34 UTSW 11 23460571 missense
R7264:Usp34 UTSW 11 23333566 missense probably benign 0.00
R7325:Usp34 UTSW 11 23419052 missense
R7343:Usp34 UTSW 11 23488868 missense
R7369:Usp34 UTSW 11 23432361 missense
R7389:Usp34 UTSW 11 23345200 missense
R7459:Usp34 UTSW 11 23364458 missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23446968 missense
R7729:Usp34 UTSW 11 23449268 missense
X0023:Usp34 UTSW 11 23375028 missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23457824 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCACAATGAGGATTTTGCTTAGTTG -3'
(R):5'- CAGTCTTTATTCAACAGAGTTGTGGG -3'

Sequencing Primer
(F):5'- CCAGAGCTTCTAACCGTA -3'
(R):5'- CAACAGAGTTGTGGGGTTTAATTTAC -3'
Posted On2019-09-13