Incidental Mutation 'R7358:Agtr1a'
ID571132
Institutional Source Beutler Lab
Gene Symbol Agtr1a
Ensembl Gene ENSMUSG00000049115
Gene Nameangiotensin II receptor, type 1a
SynonymsAngtr-1a, Agtr1a, Agtr-1a, 1810074K20Rik, AT1, AT1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7358 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location30336441-30382867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30380979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 9 (D9V)
Ref Sequence ENSEMBL: ENSMUSP00000070958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066412] [ENSMUST00000221743] [ENSMUST00000222370] [ENSMUST00000222503] [ENSMUST00000223201]
Predicted Effect probably benign
Transcript: ENSMUST00000066412
AA Change: D9V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000070958
Gene: ENSMUSG00000049115
AA Change: D9V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 316 8.2e-10 PFAM
Pfam:7tm_1 45 302 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221743
AA Change: D9V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000222370
AA Change: D9V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000222503
AA Change: D9V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000223201
AA Change: D9V

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous inactivation of this gene causes hypotension and hyperreninemia, alters drinking behavior and vascular and hemodynamic responses to angiotensin II, and may lead to abnormal physiological response to xenobiotics, abnormal kidney morphology, andreduced cell numbers in specific brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,292,013 L1721S possibly damaging Het
Abca17 T A 17: 24,291,555 Q983L probably benign Het
Ankrd13c T A 3: 157,991,737 Y326* probably null Het
Ano2 A G 6: 125,710,733 D67G probably benign Het
Arhgef5 G A 6: 43,279,573 R1205H probably damaging Het
Ascc3 T A 10: 50,714,352 Y1055* probably null Het
Atad5 C T 11: 80,133,036 A1658V probably benign Het
Atp6ap1l T C 13: 90,883,807 D252G probably damaging Het
BC067074 A G 13: 113,319,967 D849G Het
Bdkrb2 T C 12: 105,592,541 V347A possibly damaging Het
Ccdc187 A T 2: 26,255,995 L1194Q probably damaging Het
Chd9 A C 8: 90,983,487 D770A unknown Het
Chd9 A G 8: 91,034,218 D2197G unknown Het
Clip2 C A 5: 134,502,630 E774* probably null Het
Clspn A G 4: 126,566,200 T407A probably benign Het
Col24a1 T A 3: 145,293,165 probably null Het
Cradd T A 10: 95,322,775 T37S probably damaging Het
Ctbp2 A G 7: 132,998,881 F70S probably damaging Het
D3Ertd751e A T 3: 41,746,565 E6D probably damaging Het
Dst T A 1: 34,191,673 F2782L probably benign Het
Dync2h1 A G 9: 7,159,479 probably null Het
Eif2s1 G T 12: 78,881,195 G215V probably damaging Het
Epg5 A T 18: 77,959,037 D557V possibly damaging Het
Eya4 C T 10: 23,123,851 probably null Het
Fam192a T C 8: 94,575,699 N235D possibly damaging Het
Fpr1 C A 17: 17,876,980 R249L probably damaging Het
Fry A G 5: 150,416,323 T1520A probably benign Het
Gapvd1 C T 2: 34,690,461 probably null Het
Gemin4 A C 11: 76,213,452 L161* probably null Het
Gid8 A T 2: 180,717,986 K221I probably benign Het
Gm21028 A C 7: 42,578,489 C34G probably damaging Het
Gm4737 T C 16: 46,153,838 E392G probably damaging Het
Greb1 A G 12: 16,724,881 S172P probably damaging Het
Herc2 A G 7: 56,182,675 I3040V possibly damaging Het
Hmcn2 T A 2: 31,416,812 V3190E probably damaging Het
Hrnr G T 3: 93,323,141 G229* probably null Het
Igfn1 A T 1: 135,964,000 V2259D probably damaging Het
Ism2 A G 12: 87,280,040 F375S probably damaging Het
Kcnk4 T A 19: 6,926,110 D357V probably damaging Het
Knl1 A G 2: 119,070,559 R914G possibly damaging Het
Mars2 T C 1: 55,237,570 S111P probably damaging Het
Mogat2 G A 7: 99,232,466 P88S possibly damaging Het
Msh2 T A 17: 87,717,529 S612T possibly damaging Het
Nvl A G 1: 181,135,036 L123P probably damaging Het
Olfr1029 T A 2: 85,975,436 S64R possibly damaging Het
Olfr352 T C 2: 36,869,878 V104A probably benign Het
Olfr621-ps1 A G 7: 103,629,183 L259P unknown Het
Olfr709-ps1 A T 7: 106,926,904 L185Q probably damaging Het
Olfr771 T A 10: 129,160,070 I305F probably benign Het
Olfr868 A T 9: 20,100,873 Y38F probably damaging Het
P2rx7 A T 5: 122,666,142 probably null Het
Pard3 A T 8: 127,593,092 I1149L probably damaging Het
Pcdha8 T A 18: 36,992,777 I104N probably damaging Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pgap2 A T 7: 102,210,567 probably benign Het
Phf7 T C 14: 31,241,788 R76G probably benign Het
Pigu T C 2: 155,299,170 T268A probably damaging Het
Piwil4 T C 9: 14,729,993 T231A possibly damaging Het
Pkd1l1 T G 11: 8,945,202 E636A Het
Plscr3 T C 11: 69,847,490 S55P unknown Het
Pnlip T A 19: 58,676,544 I268N probably damaging Het
Podxl A T 6: 31,524,994 H343Q probably benign Het
Prkcd T C 14: 30,605,836 T213A probably benign Het
Prss22 T A 17: 23,996,445 Q119L probably benign Het
Ptprcap A G 19: 4,156,239 E107G possibly damaging Het
Ptprg A G 14: 12,154,198 T640A possibly damaging Het
Ptprh A T 7: 4,551,007 probably null Het
Rasa4 A G 5: 136,095,594 T166A probably benign Het
Sbf2 T C 7: 110,399,348 E626G possibly damaging Het
Scn2a T A 2: 65,682,506 Y203* probably null Het
Serpinb1a G C 13: 32,842,998 H320Q probably damaging Het
Shisa7 G A 7: 4,829,921 T464I probably benign Het
Slc47a2 G A 11: 61,308,873 A399V possibly damaging Het
Smim4 A G 14: 31,124,603 V53A probably damaging Het
Snrnp200 A G 2: 127,221,826 T642A probably benign Het
Spag16 A G 1: 69,844,367 H85R probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stag3 C A 5: 138,301,508 L894M probably damaging Het
Sun2 A T 15: 79,734,112 F284Y probably benign Het
Tpx2 T A 2: 152,876,630 N184K probably benign Het
Trpa1 A T 1: 14,898,110 N477K probably damaging Het
Ttbk2 C T 2: 120,790,310 R157H probably damaging Het
Ttn C T 2: 76,707,305 E34760K probably benign Het
Tysnd1 T C 10: 61,696,648 S360P probably damaging Het
Usp34 T A 11: 23,361,683 L511I probably damaging Het
Vmn2r71 A T 7: 85,624,260 T761S possibly damaging Het
Zdhhc18 G T 4: 133,633,171 C73* probably null Het
Zfp975 A T 7: 42,662,791 C133S probably damaging Het
Zfy1 T C Y: 735,141 E214G unknown Het
Zmym5 T A 14: 56,794,140 K504* probably null Het
Other mutations in Agtr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Agtr1a APN 13 30381828 missense probably damaging 1.00
IGL01738:Agtr1a APN 13 30381038 missense probably benign 0.00
IGL01870:Agtr1a APN 13 30381327 missense probably damaging 1.00
IGL02293:Agtr1a APN 13 30381357 missense probably benign
IGL03411:Agtr1a APN 13 30381599 missense possibly damaging 0.49
R0012:Agtr1a UTSW 13 30381749 missense probably damaging 0.99
R0148:Agtr1a UTSW 13 30381944 missense probably benign 0.33
R0584:Agtr1a UTSW 13 30381034 missense probably damaging 1.00
R0622:Agtr1a UTSW 13 30381681 missense probably benign 0.00
R0730:Agtr1a UTSW 13 30381296 missense probably damaging 1.00
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R4075:Agtr1a UTSW 13 30381834 missense probably damaging 1.00
R4757:Agtr1a UTSW 13 30381859 nonsense probably null
R5677:Agtr1a UTSW 13 30381584 missense probably damaging 1.00
R5722:Agtr1a UTSW 13 30382033 makesense probably null
R6355:Agtr1a UTSW 13 30381499 missense probably benign 0.04
R6633:Agtr1a UTSW 13 30381467 missense probably benign 0.01
R7325:Agtr1a UTSW 13 30381907 missense possibly damaging 0.86
R7465:Agtr1a UTSW 13 30381981 missense probably benign 0.03
X0025:Agtr1a UTSW 13 30381468 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCATACGCTCCGGAAAAGTG -3'
(R):5'- TTAGAAGAAAGACACTGGCCAC -3'

Sequencing Primer
(F):5'- TTTTCCCCCAAAGAGTAAAGTAGAAC -3'
(R):5'- CCACAGTCTTCAGCTTCATGTAAAAG -3'
Posted On2019-09-13