Incidental Mutation 'R7359:Dpy19l4'
ID571173
Institutional Source Beutler Lab
Gene Symbol Dpy19l4
Ensembl Gene ENSMUSG00000045205
Gene Namedpy-19-like 4 (C. elegans)
SynonymsNarg3, LOC381510
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7359 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11261315-11322137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11273125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 576 (V576A)
Ref Sequence ENSEMBL: ENSMUSP00000081954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084892] [ENSMUST00000128024] [ENSMUST00000139385]
Predicted Effect probably benign
Transcript: ENSMUST00000084892
AA Change: V576A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081954
Gene: ENSMUSG00000045205
AA Change: V576A

DomainStartEndE-ValueType
Pfam:Dpy19 59 714 3e-213 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128024
SMART Domains Protein: ENSMUSP00000122823
Gene: ENSMUSG00000045205

DomainStartEndE-ValueType
Pfam:Dpy19 58 293 1e-89 PFAM
Pfam:Dpy19 291 524 4.8e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139385
AA Change: V350A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115537
Gene: ENSMUSG00000045205
AA Change: V350A

DomainStartEndE-ValueType
Pfam:Dpy19 1 258 3.2e-71 PFAM
Pfam:Dpy19 254 488 7e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Dpy19l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dpy19l4 APN 4 11290411 missense probably benign 0.00
IGL01402:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01404:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01643:Dpy19l4 APN 4 11290184 splice site probably benign
IGL01758:Dpy19l4 APN 4 11265846 missense probably damaging 1.00
IGL01896:Dpy19l4 APN 4 11267752 missense possibly damaging 0.81
IGL02222:Dpy19l4 APN 4 11281116 missense possibly damaging 0.93
IGL02314:Dpy19l4 APN 4 11267720 missense possibly damaging 0.50
IGL02422:Dpy19l4 APN 4 11265803 missense possibly damaging 0.95
IGL02565:Dpy19l4 APN 4 11309440 missense probably benign 0.14
IGL03121:Dpy19l4 APN 4 11303334 missense probably damaging 1.00
IGL03357:Dpy19l4 APN 4 11267615 missense probably damaging 1.00
IGL03368:Dpy19l4 APN 4 11290253 missense possibly damaging 0.53
R0003:Dpy19l4 UTSW 4 11267619 missense probably damaging 1.00
R0481:Dpy19l4 UTSW 4 11272993 splice site probably benign
R0506:Dpy19l4 UTSW 4 11289715 missense probably benign 0.07
R1114:Dpy19l4 UTSW 4 11287643 splice site probably benign
R1332:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1336:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1355:Dpy19l4 UTSW 4 11303371 nonsense probably null
R1421:Dpy19l4 UTSW 4 11304011 missense probably benign 0.09
R1422:Dpy19l4 UTSW 4 11317168 missense possibly damaging 0.88
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1766:Dpy19l4 UTSW 4 11303360 missense probably damaging 1.00
R1803:Dpy19l4 UTSW 4 11281020 missense possibly damaging 0.81
R2090:Dpy19l4 UTSW 4 11304344 missense probably benign 0.34
R2324:Dpy19l4 UTSW 4 11276857 unclassified probably benign
R2446:Dpy19l4 UTSW 4 11304143 splice site probably null
R3769:Dpy19l4 UTSW 4 11276868 splice site probably null
R4151:Dpy19l4 UTSW 4 11309485 missense possibly damaging 0.89
R4472:Dpy19l4 UTSW 4 11304053 missense possibly damaging 0.91
R4609:Dpy19l4 UTSW 4 11295999 nonsense probably null
R4708:Dpy19l4 UTSW 4 11277970 missense probably benign 0.00
R4722:Dpy19l4 UTSW 4 11290521 missense possibly damaging 0.84
R4997:Dpy19l4 UTSW 4 11287493 missense probably benign 0.01
R5085:Dpy19l4 UTSW 4 11265943 critical splice acceptor site probably null
R5088:Dpy19l4 UTSW 4 11303357 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11289721 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11304014 missense probably damaging 1.00
R5413:Dpy19l4 UTSW 4 11289700 missense probably damaging 1.00
R5758:Dpy19l4 UTSW 4 11276886 missense probably damaging 1.00
R6024:Dpy19l4 UTSW 4 11276876 missense probably damaging 1.00
R6312:Dpy19l4 UTSW 4 11289671 nonsense probably null
R6339:Dpy19l4 UTSW 4 11285111 missense probably damaging 0.98
R7055:Dpy19l4 UTSW 4 11290291 critical splice acceptor site probably null
R7525:Dpy19l4 UTSW 4 11317160 nonsense probably null
R7579:Dpy19l4 UTSW 4 11265909 missense probably benign 0.39
R7913:Dpy19l4 UTSW 4 11265859 nonsense probably null
R8047:Dpy19l4 UTSW 4 11317139 missense probably benign 0.00
R8049:Dpy19l4 UTSW 4 11303982 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTAGCTATCAGGAAACACGTCC -3'
(R):5'- TTCAGTGTTTAAAACAGCTGCTAGC -3'

Sequencing Primer
(F):5'- TATCAGGAAACACGTCCCATCATAG -3'
(R):5'- ATGGACTGCGTTGACTT -3'
Posted On2019-09-13