Incidental Mutation 'R7359:Cit'
ID 571178
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Name citron
Synonyms CRIK-SK, C030025P15Rik, citron kinase, Cit-k, citron-N
MMRRC Submission 045445-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7359 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115983337-116147006 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 116064633 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 505 (D505G)
Ref Sequence ENSEMBL: ENSMUSP00000062049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051704
AA Change: D505G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: D505G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102560
AA Change: D505G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: D505G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112008
AA Change: D505G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: D505G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141101
AA Change: D505G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: D505G

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Meta Mutation Damage Score 0.6611 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,236,348 (GRCm39) V1233A possibly damaging Het
Abcc9 G A 6: 142,617,408 (GRCm39) T552I probably damaging Het
Adgrf4 T C 17: 42,978,003 (GRCm39) I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 (GRCm39) D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 (GRCm39) E359G possibly damaging Het
Arhgef5 A C 6: 43,257,216 (GRCm39) T1256P probably damaging Het
Avpr1a A C 10: 122,285,283 (GRCm39) I192L possibly damaging Het
B4galnt4 A G 7: 140,651,197 (GRCm39) H926R probably damaging Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Ccdc68 C T 18: 70,089,123 (GRCm39) A222V probably benign Het
Cdc23 T C 18: 34,774,394 (GRCm39) Y295C probably benign Het
Ceacam10 T C 7: 24,480,432 (GRCm39) Y188H unknown Het
Cfap57 T A 4: 118,456,162 (GRCm39) T511S probably benign Het
Cftr T C 6: 18,221,623 (GRCm39) V245A probably benign Het
Cmah T G 13: 24,652,539 (GRCm39) N556K probably benign Het
Cspg4b T C 13: 113,478,964 (GRCm39) S1503P Het
D430041D05Rik C A 2: 104,044,482 (GRCm39) D839Y probably damaging Het
Dek T C 13: 47,259,065 (GRCm39) D47G unknown Het
Des C T 1: 75,337,596 (GRCm39) R179C probably damaging Het
Desi2 A G 1: 178,015,509 (GRCm39) N10D probably benign Het
Dlg5 T C 14: 24,214,615 (GRCm39) N679S probably damaging Het
Dnajc24 T C 2: 105,832,293 (GRCm39) Y30C probably damaging Het
Dock10 T A 1: 80,687,065 (GRCm39) H34L probably benign Het
Dock5 A G 14: 68,003,337 (GRCm39) V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 (GRCm39) V576A probably benign Het
Dusp6 A G 10: 99,099,927 (GRCm39) E125G probably benign Het
Dync1h1 T C 12: 110,591,036 (GRCm39) Y1035H probably benign Het
Dysf G A 6: 84,172,306 (GRCm39) probably null Het
En1 A G 1: 120,534,817 (GRCm39) K369E unknown Het
F2r A G 13: 95,741,194 (GRCm39) Y114H probably damaging Het
Fam184a T C 10: 53,575,318 (GRCm39) Y97C probably damaging Het
Fggy T C 4: 95,657,717 (GRCm39) V286A probably benign Het
Flot2 T C 11: 77,949,383 (GRCm39) I322T probably benign Het
Fndc1 A T 17: 8,032,318 (GRCm39) probably null Het
Frs3 A G 17: 48,010,450 (GRCm39) D28G probably damaging Het
Gimap3 C T 6: 48,742,280 (GRCm39) D217N probably benign Het
Gm128 A G 3: 95,147,934 (GRCm39) V120A probably benign Het
Gm17190 T C 13: 96,218,970 (GRCm39) V102A probably damaging Het
Gm17268 A G 11: 81,919,057 (GRCm39) V20A unknown Het
Grsf1 A T 5: 88,813,423 (GRCm39) probably null Het
Hmcn2 A T 2: 31,278,395 (GRCm39) Y1699F probably benign Het
Hnmt T A 2: 23,938,731 (GRCm39) M36L probably benign Het
Hoxd1 C A 2: 74,594,447 (GRCm39) T234K probably damaging Het
Hydin C G 8: 111,232,733 (GRCm39) S1679R probably damaging Het
Jag1 T C 2: 136,926,226 (GRCm39) R1059G probably benign Het
Kbtbd11 T C 8: 15,078,858 (GRCm39) W486R probably damaging Het
Kcnh6 A G 11: 105,909,789 (GRCm39) D438G possibly damaging Het
Lgals4 T G 7: 28,540,724 (GRCm39) F276V probably benign Het
Lrp6 G T 6: 134,427,923 (GRCm39) Y1556* probably null Het
Mpdz G A 4: 81,274,632 (GRCm39) L855F probably benign Het
Muc16 A T 9: 18,554,316 (GRCm39) D3992E unknown Het
Npc1 T C 18: 12,328,237 (GRCm39) N1024S probably benign Het
Nsfl1c A G 2: 151,336,279 (GRCm39) T18A probably benign Het
Or12e8 T A 2: 87,188,555 (GRCm39) L256I possibly damaging Het
Or12k5 A T 2: 36,895,449 (GRCm39) M59K probably damaging Het
Or2g7 G A 17: 38,378,506 (GRCm39) W148* probably null Het
Or8g31-ps1 T C 9: 39,276,775 (GRCm39) *307R probably null Het
Pcdh15 A T 10: 74,420,048 (GRCm39) K1235N probably damaging Het
Pcif1 A G 2: 164,726,251 (GRCm39) K51E probably damaging Het
Pde1b G A 15: 103,429,752 (GRCm39) D82N probably damaging Het
Phf23 T A 11: 69,889,467 (GRCm39) V167E possibly damaging Het
Pik3c2g T C 6: 139,913,620 (GRCm39) V1006A unknown Het
Pira12 T A 7: 3,901,103 (GRCm39) probably benign Het
Pkhd1l1 G T 15: 44,452,882 (GRCm39) V3936F probably damaging Het
Pnpla1 T C 17: 29,100,159 (GRCm39) V342A probably benign Het
Ppip5k1 T C 2: 121,171,329 (GRCm39) D620G possibly damaging Het
Ppl A G 16: 4,907,205 (GRCm39) L1030P possibly damaging Het
Prelid1 A T 13: 55,469,088 (GRCm39) probably benign Het
Racgap1 C T 15: 99,529,081 (GRCm39) S264N probably benign Het
Rdh13 T C 7: 4,430,696 (GRCm39) D289G probably benign Het
Rtp3 T C 9: 110,815,364 (GRCm39) I334V probably benign Het
Setd2 A T 9: 110,392,012 (GRCm39) D200V Het
Simc1 A G 13: 54,651,731 (GRCm39) S15G unknown Het
Sirpb1c A T 3: 15,887,389 (GRCm39) M150K probably benign Het
Smoc1 T A 12: 81,197,475 (GRCm39) D202E probably damaging Het
Spata31d1b A G 13: 59,860,304 (GRCm39) Y59C probably damaging Het
Stard9 A G 2: 120,528,761 (GRCm39) T1673A probably damaging Het
Tbc1d31 T A 15: 57,779,504 (GRCm39) H72Q probably benign Het
Tgfbrap1 C A 1: 43,114,693 (GRCm39) V136L probably damaging Het
Top2b A G 14: 16,407,376 (GRCm38) N720S probably null Het
Vmn1r11 T C 6: 57,115,184 (GRCm39) S283P probably damaging Het
Vmn1r19 A G 6: 57,382,080 (GRCm39) H211R probably damaging Het
Vmn2r44 A T 7: 8,370,538 (GRCm39) M836K probably benign Het
Vmn2r61 A C 7: 41,915,407 (GRCm39) H118P probably benign Het
Vps33a A G 5: 123,696,696 (GRCm39) I319T probably benign Het
Vwf T A 6: 125,543,220 (GRCm39) S151T Het
Zfp423 T C 8: 88,508,871 (GRCm39) N491S possibly damaging Het
Zfp626 T C 7: 27,507,660 (GRCm39) F23S probably damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115,984,524 (GRCm39) missense probably damaging 0.99
IGL00482:Cit APN 5 116,076,814 (GRCm39) missense probably damaging 0.97
IGL01317:Cit APN 5 116,046,775 (GRCm39) missense probably benign 0.03
IGL01335:Cit APN 5 116,046,889 (GRCm39) splice site probably benign
IGL01415:Cit APN 5 116,079,962 (GRCm39) missense possibly damaging 0.78
IGL01447:Cit APN 5 116,011,902 (GRCm39) splice site probably benign
IGL01537:Cit APN 5 116,071,913 (GRCm39) missense probably benign 0.00
IGL01621:Cit APN 5 116,130,662 (GRCm39) splice site probably benign
IGL02010:Cit APN 5 116,014,006 (GRCm39) missense probably damaging 1.00
IGL02538:Cit APN 5 116,125,048 (GRCm39) nonsense probably null
IGL02607:Cit APN 5 115,997,268 (GRCm39) missense probably benign
IGL02720:Cit APN 5 116,133,511 (GRCm39) missense probably benign 0.26
IGL02725:Cit APN 5 116,123,532 (GRCm39) missense probably benign 0.02
IGL02967:Cit APN 5 116,083,896 (GRCm39) missense probably benign 0.11
IGL02973:Cit APN 5 116,144,058 (GRCm39) missense possibly damaging 0.73
IGL03383:Cit APN 5 116,011,904 (GRCm39) splice site probably benign
PIT4514001:Cit UTSW 5 116,135,913 (GRCm39) critical splice donor site probably null
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0206:Cit UTSW 5 116,132,089 (GRCm39) missense possibly damaging 0.72
R0226:Cit UTSW 5 116,122,899 (GRCm39) missense probably damaging 0.99
R0320:Cit UTSW 5 116,117,504 (GRCm39) missense possibly damaging 0.87
R0401:Cit UTSW 5 116,123,538 (GRCm39) missense probably benign 0.06
R0480:Cit UTSW 5 116,071,452 (GRCm39) splice site probably benign
R0609:Cit UTSW 5 116,012,002 (GRCm39) missense probably damaging 0.98
R0737:Cit UTSW 5 116,084,978 (GRCm39) missense probably damaging 1.00
R1238:Cit UTSW 5 115,989,280 (GRCm39) missense probably benign 0.30
R1503:Cit UTSW 5 116,011,959 (GRCm39) missense possibly damaging 0.94
R1551:Cit UTSW 5 116,083,901 (GRCm39) missense probably benign 0.00
R1602:Cit UTSW 5 116,135,789 (GRCm39) missense probably damaging 1.00
R1720:Cit UTSW 5 116,105,956 (GRCm39) missense probably damaging 0.98
R1854:Cit UTSW 5 116,011,960 (GRCm39) missense probably damaging 1.00
R1886:Cit UTSW 5 116,071,545 (GRCm39) missense probably damaging 1.00
R2024:Cit UTSW 5 116,143,899 (GRCm39) missense probably damaging 0.97
R2024:Cit UTSW 5 116,085,983 (GRCm39) missense probably damaging 0.97
R2048:Cit UTSW 5 116,024,872 (GRCm39) splice site probably null
R2128:Cit UTSW 5 116,123,566 (GRCm39) missense possibly damaging 0.63
R2192:Cit UTSW 5 116,106,068 (GRCm39) missense probably benign 0.00
R2244:Cit UTSW 5 116,064,564 (GRCm39) missense probably damaging 1.00
R2518:Cit UTSW 5 116,125,105 (GRCm39) missense probably damaging 0.99
R2679:Cit UTSW 5 116,107,174 (GRCm39) missense probably benign 0.00
R2898:Cit UTSW 5 116,012,037 (GRCm39) splice site probably null
R2908:Cit UTSW 5 116,119,735 (GRCm39) missense probably benign 0.00
R3079:Cit UTSW 5 116,063,545 (GRCm39) missense probably damaging 0.97
R3779:Cit UTSW 5 115,997,400 (GRCm39) missense probably benign 0.01
R4081:Cit UTSW 5 116,086,109 (GRCm39) missense probably damaging 1.00
R4494:Cit UTSW 5 116,012,043 (GRCm39) missense probably damaging 1.00
R4610:Cit UTSW 5 116,132,146 (GRCm39) missense probably benign 0.01
R4757:Cit UTSW 5 116,135,608 (GRCm39) missense probably damaging 1.00
R4788:Cit UTSW 5 116,071,565 (GRCm39) missense probably damaging 1.00
R4816:Cit UTSW 5 116,046,750 (GRCm39) missense probably damaging 1.00
R4890:Cit UTSW 5 116,126,182 (GRCm39) intron probably benign
R4899:Cit UTSW 5 116,001,087 (GRCm39) missense possibly damaging 0.60
R4928:Cit UTSW 5 116,123,856 (GRCm39) missense probably benign 0.00
R5073:Cit UTSW 5 116,084,902 (GRCm39) missense probably benign 0.24
R5151:Cit UTSW 5 116,117,894 (GRCm39) missense probably damaging 1.00
R5154:Cit UTSW 5 116,126,464 (GRCm39) missense probably damaging 1.00
R5222:Cit UTSW 5 116,090,602 (GRCm39) missense probably benign 0.03
R5814:Cit UTSW 5 116,117,478 (GRCm39) missense probably damaging 1.00
R5935:Cit UTSW 5 116,063,598 (GRCm39) intron probably benign
R5946:Cit UTSW 5 116,135,593 (GRCm39) missense probably damaging 1.00
R6051:Cit UTSW 5 115,984,464 (GRCm39) missense probably benign
R6289:Cit UTSW 5 116,144,385 (GRCm39) makesense probably null
R6298:Cit UTSW 5 116,086,124 (GRCm39) missense probably damaging 1.00
R6362:Cit UTSW 5 116,024,735 (GRCm39) missense probably benign 0.01
R6545:Cit UTSW 5 115,984,493 (GRCm39) missense probably null 0.00
R6761:Cit UTSW 5 116,046,734 (GRCm39) missense probably damaging 1.00
R6798:Cit UTSW 5 116,064,585 (GRCm39) missense possibly damaging 0.56
R6814:Cit UTSW 5 116,023,022 (GRCm39) missense probably damaging 1.00
R6825:Cit UTSW 5 116,119,833 (GRCm39) missense probably damaging 0.99
R6845:Cit UTSW 5 116,122,947 (GRCm39) missense probably damaging 1.00
R6983:Cit UTSW 5 116,132,150 (GRCm39) missense probably damaging 1.00
R7164:Cit UTSW 5 116,123,846 (GRCm39) missense possibly damaging 0.94
R7597:Cit UTSW 5 116,024,740 (GRCm39) nonsense probably null
R7729:Cit UTSW 5 116,122,881 (GRCm39) missense possibly damaging 0.87
R7763:Cit UTSW 5 116,125,060 (GRCm39) missense probably benign 0.01
R7786:Cit UTSW 5 116,001,077 (GRCm39) missense probably benign 0.00
R7799:Cit UTSW 5 116,001,027 (GRCm39) missense probably benign 0.00
R8060:Cit UTSW 5 116,046,786 (GRCm39) missense probably benign 0.00
R8068:Cit UTSW 5 116,120,294 (GRCm39) missense probably benign 0.03
R8068:Cit UTSW 5 116,090,525 (GRCm39) missense probably damaging 1.00
R8122:Cit UTSW 5 116,107,069 (GRCm39) missense probably damaging 1.00
R8177:Cit UTSW 5 116,126,218 (GRCm39) missense probably benign 0.18
R8178:Cit UTSW 5 116,107,131 (GRCm39) missense probably damaging 1.00
R8265:Cit UTSW 5 116,126,236 (GRCm39) missense probably damaging 1.00
R8359:Cit UTSW 5 116,122,603 (GRCm39) splice site probably null
R8397:Cit UTSW 5 116,024,856 (GRCm39) missense probably benign
R8489:Cit UTSW 5 116,083,962 (GRCm39) critical splice donor site probably null
R8784:Cit UTSW 5 115,984,442 (GRCm39) nonsense probably null
R8798:Cit UTSW 5 116,107,102 (GRCm39) missense probably damaging 0.99
R8882:Cit UTSW 5 116,001,089 (GRCm39) missense probably benign 0.04
R8984:Cit UTSW 5 116,064,534 (GRCm39) missense possibly damaging 0.86
R9091:Cit UTSW 5 115,984,161 (GRCm39) intron probably benign
R9127:Cit UTSW 5 116,074,896 (GRCm39) nonsense probably null
R9204:Cit UTSW 5 116,126,498 (GRCm39) missense probably damaging 0.99
R9212:Cit UTSW 5 116,013,952 (GRCm39) missense possibly damaging 0.75
R9279:Cit UTSW 5 116,065,970 (GRCm39) missense probably damaging 1.00
R9288:Cit UTSW 5 116,123,512 (GRCm39) missense probably damaging 1.00
R9377:Cit UTSW 5 116,084,914 (GRCm39) missense probably benign 0.04
R9520:Cit UTSW 5 116,079,954 (GRCm39) nonsense probably null
Z1088:Cit UTSW 5 116,123,592 (GRCm39) missense possibly damaging 0.62
Z1176:Cit UTSW 5 116,124,662 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATTAGCGGTAACCACCC -3'
(R):5'- TAGTTCACGCTAACTCTGCC -3'

Sequencing Primer
(F):5'- AACCCCTCTTGACGAGTGACTG -3'
(R):5'- AACTCTGCCTTTCCACTCGGTG -3'
Posted On 2019-09-13