Mutagenetix > Incidental Mutation

Incidental Mutation 'R7359:Vps33a'

571179

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123558633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 319 (I319T)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

probably benign
Transcript: ENSMUST00000031388
AA Change: I319T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: I319T

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Meta Mutation Damage Score

0.0930

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,189,574	V1233A	possibly damaging	Het
Abcc9	G	A	6: 142,671,682	T552I	probably damaging	Het
Adgrf4	T	C	17: 42,667,112	I447V	possibly damaging	Het
Akirin2	T	A	4: 34,565,944	D178E	probably damaging	Het
Arhgap12	T	C	18: 6,065,709	E359G	possibly damaging	Het
Arhgef5	A	C	6: 43,280,282	T1256P	probably damaging	Het
Avpr1a	A	C	10: 122,449,378	I192L	possibly damaging	Het
B4galnt4	A	G	7: 141,071,284	H926R	probably damaging	Het
BC067074	T	C	13: 113,342,430	S1503P		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc68	C	T	18: 69,956,052	A222V	probably benign	Het
Cdc23	T	C	18: 34,641,341	Y295C	probably benign	Het
Ceacam10	T	C	7: 24,781,007	Y188H	unknown	Het
Cfap57	T	A	4: 118,598,965	T511S	probably benign	Het
Cftr	T	C	6: 18,221,624	V245A	probably benign	Het
Cit	A	G	5: 115,926,574	D505G	probably damaging	Het
Cmah	T	G	13: 24,468,556	N556K	probably benign	Het
D430041D05Rik	C	A	2: 104,214,137	D839Y	probably damaging	Het
Dek	T	C	13: 47,105,589	D47G	unknown	Het
Des	C	T	1: 75,360,952	R179C	probably damaging	Het
Desi2	A	G	1: 178,187,943	N10D	probably benign	Het
Dlg5	T	C	14: 24,164,547	N679S	probably damaging	Het
Dnajc24	T	C	2: 106,001,948	Y30C	probably damaging	Het
Dock10	T	A	1: 80,709,348	H34L	probably benign	Het
Dock5	A	G	14: 67,765,888	V1586A	probably benign	Het
Dpy19l4	A	G	4: 11,273,125	V576A	probably benign	Het
Dusp6	A	G	10: 99,264,065	E125G	probably benign	Het
Dync1h1	T	C	12: 110,624,602	Y1035H	probably benign	Het
Dysf	G	A	6: 84,195,324		probably null	Het
En1	A	G	1: 120,607,088	K369E	unknown	Het
F2r	A	G	13: 95,604,686	Y114H	probably damaging	Het
Fam184a	T	C	10: 53,699,222	Y97C	probably damaging	Het
Fggy	T	C	4: 95,769,480	V286A	probably benign	Het
Flot2	T	C	11: 78,058,557	I322T	probably benign	Het
Fndc1	A	T	17: 7,813,486		probably null	Het
Frs3	A	G	17: 47,699,525	D28G	probably damaging	Het
Gimap3	C	T	6: 48,765,346	D217N	probably benign	Het
Gm128	A	G	3: 95,240,623	V120A	probably benign	Het
Gm14548	T	A	7: 3,898,104		probably benign	Het
Gm17190	T	C	13: 96,082,462	V102A	probably damaging	Het
Gm17268	A	G	11: 82,028,231	V20A	unknown	Het
Grsf1	A	T	5: 88,665,564		probably null	Het
Hmcn2	A	T	2: 31,388,383	Y1699F	probably benign	Het
Hnmt	T	A	2: 24,048,719	M36L	probably benign	Het
Hoxd1	C	A	2: 74,764,103	T234K	probably damaging	Het
Hydin	C	G	8: 110,506,101	S1679R	probably damaging	Het
Jag1	T	C	2: 137,084,306	R1059G	probably benign	Het
Kbtbd11	T	C	8: 15,028,858	W486R	probably damaging	Het
Kcnh6	A	G	11: 106,018,963	D438G	possibly damaging	Het
Lgals4	T	G	7: 28,841,299	F276V	probably benign	Het
Lrp6	G	T	6: 134,450,960	Y1556*	probably null	Het
Mpdz	G	A	4: 81,356,395	L855F	probably benign	Het
Muc16	A	T	9: 18,643,020	D3992E	unknown	Het
Npc1	T	C	18: 12,195,180	N1024S	probably benign	Het
Nsfl1c	A	G	2: 151,494,359	T18A	probably benign	Het
Olfr1120	T	A	2: 87,358,211	L256I	possibly damaging	Het
Olfr130	G	A	17: 38,067,615	W148*	probably null	Het
Olfr358	A	T	2: 37,005,437	M59K	probably damaging	Het
Olfr949-ps1	T	C	9: 39,365,479	*307R	probably null	Het
Pcdh15	A	T	10: 74,584,216	K1235N	probably damaging	Het
Pcif1	A	G	2: 164,884,331	K51E	probably damaging	Het
Pde1b	G	A	15: 103,521,325	D82N	probably damaging	Het
Phf23	T	A	11: 69,998,641	V167E	possibly damaging	Het
Pik3c2g	T	C	6: 139,967,894	V1006A	unknown	Het
Pkhd1l1	G	T	15: 44,589,486	V3936F	probably damaging	Het
Pnpla1	T	C	17: 28,881,185	V342A	probably benign	Het
Ppip5k1	T	C	2: 121,340,848	D620G	possibly damaging	Het
Ppl	A	G	16: 5,089,341	L1030P	possibly damaging	Het
Prelid1	A	T	13: 55,321,275		probably benign	Het
Racgap1	C	T	15: 99,631,200	S264N	probably benign	Het
Rdh13	T	C	7: 4,427,697	D289G	probably benign	Het
Rtp3	T	C	9: 110,986,296	I334V	probably benign	Het
Setd2	A	T	9: 110,562,944	D200V		Het
Simc1	A	G	13: 54,503,918	S15G	unknown	Het
Sirpb1c	A	T	3: 15,833,225	M150K	probably benign	Het
Smoc1	T	A	12: 81,150,701	D202E	probably damaging	Het
Spata31d1b	A	G	13: 59,712,490	Y59C	probably damaging	Het
Stard9	A	G	2: 120,698,280	T1673A	probably damaging	Het
Tbc1d31	T	A	15: 57,916,108	H72Q	probably benign	Het
Tgfbrap1	C	A	1: 43,075,533	V136L	probably damaging	Het
Top2b	A	G	14: 16,407,376	N720S	probably null	Het
Vmn1r11	T	C	6: 57,138,199	S283P	probably damaging	Het
Vmn1r19	A	G	6: 57,405,095	H211R	probably damaging	Het
Vmn2r44	A	T	7: 8,367,539	M836K	probably benign	Het
Vmn2r61	A	C	7: 42,265,983	H118P	probably benign	Het
Vwf	T	A	6: 125,566,257	S151T		Het
Zfp423	T	C	8: 87,782,243	N491S	possibly damaging	Het
Zfp626	T	C	7: 27,808,235	F23S	probably damaging	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R2926:Vps33a	UTSW	5	123569571	missense	possibly damaging	0.83
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- GTTTGAGGACCTTTAATTTCCAAGG -3'
(R):5'- GCCTCCAGAGAAGTTTGCAC -3'

Sequencing Primer
(F):5'- CTTTACAAGTCAGCATGCATGGGC -3'
(R):5'- TTTGCACCCAAGAAGCAGG -3'

Posted On

2019-09-13