Mutagenetix > Incidental Mutation

Incidental Mutation 'R7359:Arhgef5'

571181

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 43280282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1256 (T1256P)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: T1256P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T1256P

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,189,574	V1233A	possibly damaging	Het
Abcc9	G	A	6: 142,671,682	T552I	probably damaging	Het
Adgrf4	T	C	17: 42,667,112	I447V	possibly damaging	Het
Akirin2	T	A	4: 34,565,944	D178E	probably damaging	Het
Arhgap12	T	C	18: 6,065,709	E359G	possibly damaging	Het
Avpr1a	A	C	10: 122,449,378	I192L	possibly damaging	Het
B4galnt4	A	G	7: 141,071,284	H926R	probably damaging	Het
BC067074	T	C	13: 113,342,430	S1503P		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc68	C	T	18: 69,956,052	A222V	probably benign	Het
Cdc23	T	C	18: 34,641,341	Y295C	probably benign	Het
Ceacam10	T	C	7: 24,781,007	Y188H	unknown	Het
Cfap57	T	A	4: 118,598,965	T511S	probably benign	Het
Cftr	T	C	6: 18,221,624	V245A	probably benign	Het
Cit	A	G	5: 115,926,574	D505G	probably damaging	Het
Cmah	T	G	13: 24,468,556	N556K	probably benign	Het
D430041D05Rik	C	A	2: 104,214,137	D839Y	probably damaging	Het
Dek	T	C	13: 47,105,589	D47G	unknown	Het
Des	C	T	1: 75,360,952	R179C	probably damaging	Het
Desi2	A	G	1: 178,187,943	N10D	probably benign	Het
Dlg5	T	C	14: 24,164,547	N679S	probably damaging	Het
Dnajc24	T	C	2: 106,001,948	Y30C	probably damaging	Het
Dock10	T	A	1: 80,709,348	H34L	probably benign	Het
Dock5	A	G	14: 67,765,888	V1586A	probably benign	Het
Dpy19l4	A	G	4: 11,273,125	V576A	probably benign	Het
Dusp6	A	G	10: 99,264,065	E125G	probably benign	Het
Dync1h1	T	C	12: 110,624,602	Y1035H	probably benign	Het
Dysf	G	A	6: 84,195,324		probably null	Het
En1	A	G	1: 120,607,088	K369E	unknown	Het
F2r	A	G	13: 95,604,686	Y114H	probably damaging	Het
Fam184a	T	C	10: 53,699,222	Y97C	probably damaging	Het
Fggy	T	C	4: 95,769,480	V286A	probably benign	Het
Flot2	T	C	11: 78,058,557	I322T	probably benign	Het
Fndc1	A	T	17: 7,813,486		probably null	Het
Frs3	A	G	17: 47,699,525	D28G	probably damaging	Het
Gimap3	C	T	6: 48,765,346	D217N	probably benign	Het
Gm128	A	G	3: 95,240,623	V120A	probably benign	Het
Gm14548	T	A	7: 3,898,104		probably benign	Het
Gm17190	T	C	13: 96,082,462	V102A	probably damaging	Het
Gm17268	A	G	11: 82,028,231	V20A	unknown	Het
Grsf1	A	T	5: 88,665,564		probably null	Het
Hmcn2	A	T	2: 31,388,383	Y1699F	probably benign	Het
Hnmt	T	A	2: 24,048,719	M36L	probably benign	Het
Hoxd1	C	A	2: 74,764,103	T234K	probably damaging	Het
Hydin	C	G	8: 110,506,101	S1679R	probably damaging	Het
Jag1	T	C	2: 137,084,306	R1059G	probably benign	Het
Kbtbd11	T	C	8: 15,028,858	W486R	probably damaging	Het
Kcnh6	A	G	11: 106,018,963	D438G	possibly damaging	Het
Lgals4	T	G	7: 28,841,299	F276V	probably benign	Het
Lrp6	G	T	6: 134,450,960	Y1556*	probably null	Het
Mpdz	G	A	4: 81,356,395	L855F	probably benign	Het
Muc16	A	T	9: 18,643,020	D3992E	unknown	Het
Npc1	T	C	18: 12,195,180	N1024S	probably benign	Het
Nsfl1c	A	G	2: 151,494,359	T18A	probably benign	Het
Olfr1120	T	A	2: 87,358,211	L256I	possibly damaging	Het
Olfr130	G	A	17: 38,067,615	W148*	probably null	Het
Olfr358	A	T	2: 37,005,437	M59K	probably damaging	Het
Olfr949-ps1	T	C	9: 39,365,479	*307R	probably null	Het
Pcdh15	A	T	10: 74,584,216	K1235N	probably damaging	Het
Pcif1	A	G	2: 164,884,331	K51E	probably damaging	Het
Pde1b	G	A	15: 103,521,325	D82N	probably damaging	Het
Phf23	T	A	11: 69,998,641	V167E	possibly damaging	Het
Pik3c2g	T	C	6: 139,967,894	V1006A	unknown	Het
Pkhd1l1	G	T	15: 44,589,486	V3936F	probably damaging	Het
Pnpla1	T	C	17: 28,881,185	V342A	probably benign	Het
Ppip5k1	T	C	2: 121,340,848	D620G	possibly damaging	Het
Ppl	A	G	16: 5,089,341	L1030P	possibly damaging	Het
Prelid1	A	T	13: 55,321,275		probably benign	Het
Racgap1	C	T	15: 99,631,200	S264N	probably benign	Het
Rdh13	T	C	7: 4,427,697	D289G	probably benign	Het
Rtp3	T	C	9: 110,986,296	I334V	probably benign	Het
Setd2	A	T	9: 110,562,944	D200V		Het
Simc1	A	G	13: 54,503,918	S15G	unknown	Het
Sirpb1c	A	T	3: 15,833,225	M150K	probably benign	Het
Smoc1	T	A	12: 81,150,701	D202E	probably damaging	Het
Spata31d1b	A	G	13: 59,712,490	Y59C	probably damaging	Het
Stard9	A	G	2: 120,698,280	T1673A	probably damaging	Het
Tbc1d31	T	A	15: 57,916,108	H72Q	probably benign	Het
Tgfbrap1	C	A	1: 43,075,533	V136L	probably damaging	Het
Top2b	A	G	14: 16,407,376	N720S	probably null	Het
Vmn1r11	T	C	6: 57,138,199	S283P	probably damaging	Het
Vmn1r19	A	G	6: 57,405,095	H211R	probably damaging	Het
Vmn2r44	A	T	7: 8,367,539	M836K	probably benign	Het
Vmn2r61	A	C	7: 42,265,983	H118P	probably benign	Het
Vps33a	A	G	5: 123,558,633	I319T	probably benign	Het
Vwf	T	A	6: 125,566,257	S151T		Het
Zfp423	T	C	8: 87,782,243	N491S	possibly damaging	Het
Zfp626	T	C	7: 27,808,235	F23S	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGACTCAGACAGATGCTGG -3'
(R):5'- AGGAGAATCCATGTACAGGGTCC -3'

Sequencing Primer
(F):5'- CTCAGACAGATGCTGGGCTGAG -3'
(R):5'- TCCATGTACAGGGTCCAGATATGAC -3'

Posted On

2019-09-13