Incidental Mutation 'R7359:Pik3c2g'
ID571187
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Namephosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7359 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location139587221-139969284 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139967894 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1006 (V1006A)
Ref Sequence ENSEMBL: ENSMUSP00000107499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087657
AA Change: V638A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: V638A

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111868
AA Change: V1006A
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: V1006A

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000218528
AA Change: V888A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139896125 missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139852857 missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139754741 nonsense probably null
IGL01580:Pik3c2g APN 6 139622516 missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139754741 nonsense probably null
IGL01813:Pik3c2g APN 6 139622409 missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139860355 missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139918004 missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139852800 missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139736973 missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139967828 missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139772407 critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4340:Pik3c2g UTSW 6 139635656 frame shift probably null
FR4976:Pik3c2g UTSW 6 139635654 frame shift probably null
IGL02837:Pik3c2g UTSW 6 139626564 nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139859370 missense
R0002:Pik3c2g UTSW 6 139768745 missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139957793 missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139662443 missense unknown
R0719:Pik3c2g UTSW 6 139629725 missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139957699 splice site probably benign
R0840:Pik3c2g UTSW 6 139896072 missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139772428 missense probably benign
R1501:Pik3c2g UTSW 6 139844070 critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139748178 missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139635636 intron probably benign
R1907:Pik3c2g UTSW 6 139844042 missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139900386 critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139622548 missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139855286 nonsense probably null
R2188:Pik3c2g UTSW 6 139852874 missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139622387 missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139855292 missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139852863 missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139635610 intron probably benign
R4108:Pik3c2g UTSW 6 139730370 missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139841681 intron probably benign
R4474:Pik3c2g UTSW 6 139633751 missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139720006 missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139720018 missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139935985 missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139768779 missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139967802 missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139843931 missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139896202 missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5072:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5073:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5074:Pik3c2g UTSW 6 139720147 missense probably null 0.00
R5107:Pik3c2g UTSW 6 139635625 intron probably benign
R5186:Pik3c2g UTSW 6 139622018 missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139896257 critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139622123 missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139720082 missense probably benign
R5417:Pik3c2g UTSW 6 139736943 missense probably benign
R5435:Pik3c2g UTSW 6 139715855 unclassified probably null
R5580:Pik3c2g UTSW 6 139626533 missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139737007 missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139768710 missense probably damaging 1.00
R5914:Pik3c2g UTSW 6 139622479 missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139622139 missense probably damaging 0.96
R6046:Pik3c2g UTSW 6 139896792 missense probably damaging 1.00
R6298:Pik3c2g UTSW 6 139626563 missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139719998 missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139730469 missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139896173 missense probably benign 0.00
R6929:Pik3c2g UTSW 6 139957776 missense possibly damaging 0.67
R7022:Pik3c2g UTSW 6 139622063 missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139629870 missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139860264 missense
R7215:Pik3c2g UTSW 6 139754863 missense
R7332:Pik3c2g UTSW 6 139896255 missense
R7357:Pik3c2g UTSW 6 139633793 critical splice donor site probably null
R7385:Pik3c2g UTSW 6 139855353 missense
R7455:Pik3c2g UTSW 6 139967917 missense unknown
R7651:Pik3c2g UTSW 6 139622072 missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139896744 missense
R8005:Pik3c2g UTSW 6 139622069 missense probably benign 0.01
RF015:Pik3c2g UTSW 6 139754771 missense
RF032:Pik3c2g UTSW 6 139635658 frame shift probably null
X0024:Pik3c2g UTSW 6 139860258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCCAAGGTATAAGTTGTTAGC -3'
(R):5'- AAAGGCAGATTTTGATCTGGTTC -3'

Sequencing Primer
(F):5'- CTCTCCATTTTCAGGTGGTAT -3'
(R):5'- ATGGTTTGGGTCACTACAACCAC -3'
Posted On2019-09-13