Mutagenetix > Incidental Mutation

Incidental Mutation 'R7359:Pik3c2g'

571187

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

045445-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.090) question?

Stock #

R7359 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139967894 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1006 (V1006A)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087657
AA Change: V638A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: V638A

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000111868
AA Change: V1006A

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: V1006A

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000218528
AA Change: V888A

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,189,574	V1233A	possibly damaging	Het
Abcc9	G	A	6: 142,671,682	T552I	probably damaging	Het
Adgrf4	T	C	17: 42,667,112	I447V	possibly damaging	Het
Akirin2	T	A	4: 34,565,944	D178E	probably damaging	Het
Arhgap12	T	C	18: 6,065,709	E359G	possibly damaging	Het
Arhgef5	A	C	6: 43,280,282	T1256P	probably damaging	Het
Avpr1a	A	C	10: 122,449,378	I192L	possibly damaging	Het
B4galnt4	A	G	7: 141,071,284	H926R	probably damaging	Het
BC067074	T	C	13: 113,342,430	S1503P		Het
Bean1	CT	C	8: 104,182,032		probably null	Het
Ccdc68	C	T	18: 69,956,052	A222V	probably benign	Het
Cdc23	T	C	18: 34,641,341	Y295C	probably benign	Het
Ceacam10	T	C	7: 24,781,007	Y188H	unknown	Het
Cfap57	T	A	4: 118,598,965	T511S	probably benign	Het
Cftr	T	C	6: 18,221,624	V245A	probably benign	Het
Cit	A	G	5: 115,926,574	D505G	probably damaging	Het
Cmah	T	G	13: 24,468,556	N556K	probably benign	Het
D430041D05Rik	C	A	2: 104,214,137	D839Y	probably damaging	Het
Dek	T	C	13: 47,105,589	D47G	unknown	Het
Des	C	T	1: 75,360,952	R179C	probably damaging	Het
Desi2	A	G	1: 178,187,943	N10D	probably benign	Het
Dlg5	T	C	14: 24,164,547	N679S	probably damaging	Het
Dnajc24	T	C	2: 106,001,948	Y30C	probably damaging	Het
Dock10	T	A	1: 80,709,348	H34L	probably benign	Het
Dock5	A	G	14: 67,765,888	V1586A	probably benign	Het
Dpy19l4	A	G	4: 11,273,125	V576A	probably benign	Het
Dusp6	A	G	10: 99,264,065	E125G	probably benign	Het
Dync1h1	T	C	12: 110,624,602	Y1035H	probably benign	Het
Dysf	G	A	6: 84,195,324		probably null	Het
En1	A	G	1: 120,607,088	K369E	unknown	Het
F2r	A	G	13: 95,604,686	Y114H	probably damaging	Het
Fam184a	T	C	10: 53,699,222	Y97C	probably damaging	Het
Fggy	T	C	4: 95,769,480	V286A	probably benign	Het
Flot2	T	C	11: 78,058,557	I322T	probably benign	Het
Fndc1	A	T	17: 7,813,486		probably null	Het
Frs3	A	G	17: 47,699,525	D28G	probably damaging	Het
Gimap3	C	T	6: 48,765,346	D217N	probably benign	Het
Gm128	A	G	3: 95,240,623	V120A	probably benign	Het
Gm14548	T	A	7: 3,898,104		probably benign	Het
Gm17190	T	C	13: 96,082,462	V102A	probably damaging	Het
Gm17268	A	G	11: 82,028,231	V20A	unknown	Het
Grsf1	A	T	5: 88,665,564		probably null	Het
Hmcn2	A	T	2: 31,388,383	Y1699F	probably benign	Het
Hnmt	T	A	2: 24,048,719	M36L	probably benign	Het
Hoxd1	C	A	2: 74,764,103	T234K	probably damaging	Het
Hydin	C	G	8: 110,506,101	S1679R	probably damaging	Het
Jag1	T	C	2: 137,084,306	R1059G	probably benign	Het
Kbtbd11	T	C	8: 15,028,858	W486R	probably damaging	Het
Kcnh6	A	G	11: 106,018,963	D438G	possibly damaging	Het
Lgals4	T	G	7: 28,841,299	F276V	probably benign	Het
Lrp6	G	T	6: 134,450,960	Y1556*	probably null	Het
Mpdz	G	A	4: 81,356,395	L855F	probably benign	Het
Muc16	A	T	9: 18,643,020	D3992E	unknown	Het
Npc1	T	C	18: 12,195,180	N1024S	probably benign	Het
Nsfl1c	A	G	2: 151,494,359	T18A	probably benign	Het
Olfr1120	T	A	2: 87,358,211	L256I	possibly damaging	Het
Olfr130	G	A	17: 38,067,615	W148*	probably null	Het
Olfr358	A	T	2: 37,005,437	M59K	probably damaging	Het
Olfr949-ps1	T	C	9: 39,365,479	*307R	probably null	Het
Pcdh15	A	T	10: 74,584,216	K1235N	probably damaging	Het
Pcif1	A	G	2: 164,884,331	K51E	probably damaging	Het
Pde1b	G	A	15: 103,521,325	D82N	probably damaging	Het
Phf23	T	A	11: 69,998,641	V167E	possibly damaging	Het
Pkhd1l1	G	T	15: 44,589,486	V3936F	probably damaging	Het
Pnpla1	T	C	17: 28,881,185	V342A	probably benign	Het
Ppip5k1	T	C	2: 121,340,848	D620G	possibly damaging	Het
Ppl	A	G	16: 5,089,341	L1030P	possibly damaging	Het
Prelid1	A	T	13: 55,321,275		probably benign	Het
Racgap1	C	T	15: 99,631,200	S264N	probably benign	Het
Rdh13	T	C	7: 4,427,697	D289G	probably benign	Het
Rtp3	T	C	9: 110,986,296	I334V	probably benign	Het
Setd2	A	T	9: 110,562,944	D200V		Het
Simc1	A	G	13: 54,503,918	S15G	unknown	Het
Sirpb1c	A	T	3: 15,833,225	M150K	probably benign	Het
Smoc1	T	A	12: 81,150,701	D202E	probably damaging	Het
Spata31d1b	A	G	13: 59,712,490	Y59C	probably damaging	Het
Stard9	A	G	2: 120,698,280	T1673A	probably damaging	Het
Tbc1d31	T	A	15: 57,916,108	H72Q	probably benign	Het
Tgfbrap1	C	A	1: 43,075,533	V136L	probably damaging	Het
Top2b	A	G	14: 16,407,376	N720S	probably null	Het
Vmn1r11	T	C	6: 57,138,199	S283P	probably damaging	Het
Vmn1r19	A	G	6: 57,405,095	H211R	probably damaging	Het
Vmn2r44	A	T	7: 8,367,539	M836K	probably benign	Het
Vmn2r61	A	C	7: 42,265,983	H118P	probably benign	Het
Vps33a	A	G	5: 123,558,633	I319T	probably benign	Het
Vwf	T	A	6: 125,566,257	S151T		Het
Zfp423	T	C	8: 87,782,243	N491S	possibly damaging	Het
Zfp626	T	C	7: 27,808,235	F23S	probably damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTCCAAGGTATAAGTTGTTAGC -3'
(R):5'- AAAGGCAGATTTTGATCTGGTTC -3'

Sequencing Primer
(F):5'- CTCTCCATTTTCAGGTGGTAT -3'
(R):5'- ATGGTTTGGGTCACTACAACCAC -3'

Posted On

2019-09-13