Incidental Mutation 'R7359:Avpr1a'
ID571208
Institutional Source Beutler Lab
Gene Symbol Avpr1a
Ensembl Gene ENSMUSG00000020123
Gene Namearginine vasopressin receptor 1A
SynonymsV1aR
MMRRC Submission
Accession Numbers

Genbank: NM_016847; MGI: 1859216

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R7359 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location122448499-122453452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122449378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 192 (I192L)
Ref Sequence ENSEMBL: ENSMUSP00000020323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020323
AA Change: I192L

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020323
Gene: ENSMUSG00000020123
AA Change: I192L

DomainStartEndE-ValueType
Pfam:7tm_4 58 206 8.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 62 362 6.1e-10 PFAM
Pfam:7tm_1 68 353 4.5e-49 PFAM
Pfam:7TM_GPCR_Srv 98 370 1.5e-10 PFAM
DUF1856 377 423 2e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: This gene encodes a receptor for arginine vasopressin, a neurohypophyseal hormone involved in diuresis inhibition, smooth muscle contraction, liver glycogenolysis stimulation and regulation of adrenocorticotropic hormone release from the pituitary. This receptor represents one of three G protein-coupled arginine vasopressin receptors which functions through a phosphotidylinositol-calcium second messenger system in vascular and hepatic tissues [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a stimulus processing deficit similar to that seen in schizophrenia. Anxiety-like behaviors are reduced in males but not females. B cell development is also affected. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,189,574 V1233A possibly damaging Het
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in Avpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Avpr1a APN 10 122449351 missense probably benign
IGL01062:Avpr1a APN 10 122449529 missense probably damaging 0.99
IGL01317:Avpr1a APN 10 122449567 missense probably benign
IGL01813:Avpr1a APN 10 122449011 missense probably damaging 1.00
IGL01947:Avpr1a APN 10 122452182 missense probably benign 0.00
IGL02549:Avpr1a APN 10 122452164 missense possibly damaging 0.91
IGL02967:Avpr1a APN 10 122449462 missense possibly damaging 0.95
IGL03114:Avpr1a APN 10 122449718 missense probably damaging 0.99
H8786:Avpr1a UTSW 10 122449468 missense probably benign 0.01
R0211:Avpr1a UTSW 10 122449469 missense possibly damaging 0.54
R0268:Avpr1a UTSW 10 122449709 missense probably damaging 1.00
R1188:Avpr1a UTSW 10 122448919 missense possibly damaging 0.85
R1909:Avpr1a UTSW 10 122452208 missense probably benign
R1935:Avpr1a UTSW 10 122449790 critical splice donor site probably null
R2404:Avpr1a UTSW 10 122449210 missense possibly damaging 0.78
R3707:Avpr1a UTSW 10 122449109 missense probably damaging 1.00
R3927:Avpr1a UTSW 10 122449711 missense probably benign 0.00
R4722:Avpr1a UTSW 10 122449001 missense possibly damaging 0.62
R4952:Avpr1a UTSW 10 122449754 missense probably damaging 0.98
R5384:Avpr1a UTSW 10 122449369 missense probably damaging 1.00
R5807:Avpr1a UTSW 10 122449471 missense probably benign 0.14
R6024:Avpr1a UTSW 10 122449148 missense probably damaging 0.99
R7043:Avpr1a UTSW 10 122449681 missense probably damaging 1.00
R7455:Avpr1a UTSW 10 122449264 missense probably damaging 1.00
Z1088:Avpr1a UTSW 10 122449577 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTGTTACCACAGCTGTGC -3'
(R):5'- ATTGCGCCAGATGTGGTAAC -3'

Sequencing Primer
(F):5'- AAGCACTTGCAGGTGTTTGCC -3'
(R):5'- CAGATGAAGCCATAGCAGGTACC -3'
Posted On2019-09-13