Incidental Mutation 'R7359:2700049A03Rik'
ID571213
Institutional Source Beutler Lab
Gene Symbol 2700049A03Rik
Ensembl Gene ENSMUSG00000034601
Gene NameRIKEN cDNA 2700049A03 gene
Synonymstalpid3
Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7359 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location71136848-71243303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71189574 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1233 (V1233A)
Ref Sequence ENSEMBL: ENSMUSP00000118956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045907
AA Change: V1233A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: V1233A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1351 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149564
AA Change: V1233A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: V1233A

DomainStartEndE-ValueType
Pfam:TALPID3 116 1349 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 G A 6: 142,671,682 T552I probably damaging Het
Adgrf4 T C 17: 42,667,112 I447V possibly damaging Het
Akirin2 T A 4: 34,565,944 D178E probably damaging Het
Arhgap12 T C 18: 6,065,709 E359G possibly damaging Het
Arhgef5 A C 6: 43,280,282 T1256P probably damaging Het
Avpr1a A C 10: 122,449,378 I192L possibly damaging Het
B4galnt4 A G 7: 141,071,284 H926R probably damaging Het
BC067074 T C 13: 113,342,430 S1503P Het
Bean1 CT C 8: 104,182,032 probably null Het
Ccdc68 C T 18: 69,956,052 A222V probably benign Het
Cdc23 T C 18: 34,641,341 Y295C probably benign Het
Ceacam10 T C 7: 24,781,007 Y188H unknown Het
Cfap57 T A 4: 118,598,965 T511S probably benign Het
Cftr T C 6: 18,221,624 V245A probably benign Het
Cit A G 5: 115,926,574 D505G probably damaging Het
Cmah T G 13: 24,468,556 N556K probably benign Het
D430041D05Rik C A 2: 104,214,137 D839Y probably damaging Het
Dek T C 13: 47,105,589 D47G unknown Het
Des C T 1: 75,360,952 R179C probably damaging Het
Desi2 A G 1: 178,187,943 N10D probably benign Het
Dlg5 T C 14: 24,164,547 N679S probably damaging Het
Dnajc24 T C 2: 106,001,948 Y30C probably damaging Het
Dock10 T A 1: 80,709,348 H34L probably benign Het
Dock5 A G 14: 67,765,888 V1586A probably benign Het
Dpy19l4 A G 4: 11,273,125 V576A probably benign Het
Dusp6 A G 10: 99,264,065 E125G probably benign Het
Dync1h1 T C 12: 110,624,602 Y1035H probably benign Het
Dysf G A 6: 84,195,324 probably null Het
En1 A G 1: 120,607,088 K369E unknown Het
F2r A G 13: 95,604,686 Y114H probably damaging Het
Fam184a T C 10: 53,699,222 Y97C probably damaging Het
Fggy T C 4: 95,769,480 V286A probably benign Het
Flot2 T C 11: 78,058,557 I322T probably benign Het
Fndc1 A T 17: 7,813,486 probably null Het
Frs3 A G 17: 47,699,525 D28G probably damaging Het
Gimap3 C T 6: 48,765,346 D217N probably benign Het
Gm128 A G 3: 95,240,623 V120A probably benign Het
Gm14548 T A 7: 3,898,104 probably benign Het
Gm17190 T C 13: 96,082,462 V102A probably damaging Het
Gm17268 A G 11: 82,028,231 V20A unknown Het
Grsf1 A T 5: 88,665,564 probably null Het
Hmcn2 A T 2: 31,388,383 Y1699F probably benign Het
Hnmt T A 2: 24,048,719 M36L probably benign Het
Hoxd1 C A 2: 74,764,103 T234K probably damaging Het
Hydin C G 8: 110,506,101 S1679R probably damaging Het
Jag1 T C 2: 137,084,306 R1059G probably benign Het
Kbtbd11 T C 8: 15,028,858 W486R probably damaging Het
Kcnh6 A G 11: 106,018,963 D438G possibly damaging Het
Lgals4 T G 7: 28,841,299 F276V probably benign Het
Lrp6 G T 6: 134,450,960 Y1556* probably null Het
Mpdz G A 4: 81,356,395 L855F probably benign Het
Muc16 A T 9: 18,643,020 D3992E unknown Het
Npc1 T C 18: 12,195,180 N1024S probably benign Het
Nsfl1c A G 2: 151,494,359 T18A probably benign Het
Olfr1120 T A 2: 87,358,211 L256I possibly damaging Het
Olfr130 G A 17: 38,067,615 W148* probably null Het
Olfr358 A T 2: 37,005,437 M59K probably damaging Het
Olfr949-ps1 T C 9: 39,365,479 *307R probably null Het
Pcdh15 A T 10: 74,584,216 K1235N probably damaging Het
Pcif1 A G 2: 164,884,331 K51E probably damaging Het
Pde1b G A 15: 103,521,325 D82N probably damaging Het
Phf23 T A 11: 69,998,641 V167E possibly damaging Het
Pik3c2g T C 6: 139,967,894 V1006A unknown Het
Pkhd1l1 G T 15: 44,589,486 V3936F probably damaging Het
Pnpla1 T C 17: 28,881,185 V342A probably benign Het
Ppip5k1 T C 2: 121,340,848 D620G possibly damaging Het
Ppl A G 16: 5,089,341 L1030P possibly damaging Het
Prelid1 A T 13: 55,321,275 probably benign Het
Racgap1 C T 15: 99,631,200 S264N probably benign Het
Rdh13 T C 7: 4,427,697 D289G probably benign Het
Rtp3 T C 9: 110,986,296 I334V probably benign Het
Setd2 A T 9: 110,562,944 D200V Het
Simc1 A G 13: 54,503,918 S15G unknown Het
Sirpb1c A T 3: 15,833,225 M150K probably benign Het
Smoc1 T A 12: 81,150,701 D202E probably damaging Het
Spata31d1b A G 13: 59,712,490 Y59C probably damaging Het
Stard9 A G 2: 120,698,280 T1673A probably damaging Het
Tbc1d31 T A 15: 57,916,108 H72Q probably benign Het
Tgfbrap1 C A 1: 43,075,533 V136L probably damaging Het
Top2b A G 14: 16,407,376 N720S probably null Het
Vmn1r11 T C 6: 57,138,199 S283P probably damaging Het
Vmn1r19 A G 6: 57,405,095 H211R probably damaging Het
Vmn2r44 A T 7: 8,367,539 M836K probably benign Het
Vmn2r61 A C 7: 42,265,983 H118P probably benign Het
Vps33a A G 5: 123,558,633 I319T probably benign Het
Vwf T A 6: 125,566,257 S151T Het
Zfp423 T C 8: 87,782,243 N491S possibly damaging Het
Zfp626 T C 7: 27,808,235 F23S probably damaging Het
Other mutations in 2700049A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:2700049A03Rik APN 12 71167119 missense probably benign 0.00
IGL01107:2700049A03Rik APN 12 71194468 critical splice donor site probably null
IGL01404:2700049A03Rik APN 12 71164378 splice site probably null
IGL01835:2700049A03Rik APN 12 71167181 nonsense probably null
IGL01835:2700049A03Rik APN 12 71167183 missense probably benign 0.00
IGL02122:2700049A03Rik APN 12 71170525 missense possibly damaging 0.93
IGL02140:2700049A03Rik APN 12 71148260 missense probably benign 0.06
IGL02385:2700049A03Rik APN 12 71154856 missense probably damaging 0.98
IGL03181:2700049A03Rik APN 12 71193373 missense possibly damaging 0.51
IGL03253:2700049A03Rik APN 12 71140883 missense probably benign 0.33
IGL03278:2700049A03Rik APN 12 71158825 splice site probably benign
G4846:2700049A03Rik UTSW 12 71137909 missense probably benign
PIT1430001:2700049A03Rik UTSW 12 71160386 missense possibly damaging 0.71
PIT4519001:2700049A03Rik UTSW 12 71170666 missense probably benign 0.05
R0108:2700049A03Rik UTSW 12 71177918 missense probably benign 0.14
R0165:2700049A03Rik UTSW 12 71167150 missense possibly damaging 0.52
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0211:2700049A03Rik UTSW 12 71216096 missense possibly damaging 0.96
R0220:2700049A03Rik UTSW 12 71148420 critical splice donor site probably null
R0352:2700049A03Rik UTSW 12 71138030 missense possibly damaging 0.96
R0468:2700049A03Rik UTSW 12 71193310 missense possibly damaging 0.71
R0508:2700049A03Rik UTSW 12 71164388 missense probably damaging 0.98
R0673:2700049A03Rik UTSW 12 71177868 missense probably damaging 0.97
R0840:2700049A03Rik UTSW 12 71158883 missense probably benign 0.16
R0893:2700049A03Rik UTSW 12 71219308 splice site probably benign
R1244:2700049A03Rik UTSW 12 71216144 missense probably benign 0.25
R1432:2700049A03Rik UTSW 12 71170587 unclassified probably null
R1599:2700049A03Rik UTSW 12 71150259 missense probably damaging 0.98
R1732:2700049A03Rik UTSW 12 71219221 missense probably benign 0.18
R1820:2700049A03Rik UTSW 12 71150244 missense possibly damaging 0.51
R1939:2700049A03Rik UTSW 12 71160412 splice site probably null
R1998:2700049A03Rik UTSW 12 71188619 missense possibly damaging 0.86
R2337:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2337:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2340:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2340:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2382:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2382:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2384:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2384:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2445:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2445:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2449:2700049A03Rik UTSW 12 71164546 nonsense probably null
R2449:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R2512:2700049A03Rik UTSW 12 71173171 missense possibly damaging 0.71
R2872:2700049A03Rik UTSW 12 71154756 splice site probably benign
R3236:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3236:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3237:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3237:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3734:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3734:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3808:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3808:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3809:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3809:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3944:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3944:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R3960:2700049A03Rik UTSW 12 71164546 nonsense probably null
R3960:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4593:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4593:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4595:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4595:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4596:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4596:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4600:2700049A03Rik UTSW 12 71148263 missense possibly damaging 0.67
R4649:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4649:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4651:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4651:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4652:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4652:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4714:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4714:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4735:2700049A03Rik UTSW 12 71216123 missense possibly damaging 0.88
R4810:2700049A03Rik UTSW 12 71189442 missense possibly damaging 0.51
R4852:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4852:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4854:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4854:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4855:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4855:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4884:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4884:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4893:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4893:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4905:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4905:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4915:2700049A03Rik UTSW 12 71189646 missense possibly damaging 0.92
R4919:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4919:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4959:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4959:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R4989:2700049A03Rik UTSW 12 71164546 nonsense probably null
R4989:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5011:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5011:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5012:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5012:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5118:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5118:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5146:2700049A03Rik UTSW 12 71243025 missense possibly damaging 0.85
R5163:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5163:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5188:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5188:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5189:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5189:2700049A03Rik UTSW 12 71193349 missense possibly damaging 0.93
R5190:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5190:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5290:2700049A03Rik UTSW 12 71188791 missense probably benign 0.00
R5344:2700049A03Rik UTSW 12 71243027 missense probably benign
R5502:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5502:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5503:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5503:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5619:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5619:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5667:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5667:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5669:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5669:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5671:2700049A03Rik UTSW 12 71164546 nonsense probably null
R5671:2700049A03Rik UTSW 12 71164547 missense possibly damaging 0.93
R5725:2700049A03Rik UTSW 12 71193319 missense probably benign 0.05
R5956:2700049A03Rik UTSW 12 71157119 missense possibly damaging 0.86
R6051:2700049A03Rik UTSW 12 71184530 missense possibly damaging 0.84
R6148:2700049A03Rik UTSW 12 71187426 missense possibly damaging 0.71
R6158:2700049A03Rik UTSW 12 71170636 missense possibly damaging 0.51
R6916:2700049A03Rik UTSW 12 71164544 missense possibly damaging 0.86
R7129:2700049A03Rik UTSW 12 71216230 intron probably null
R7168:2700049A03Rik UTSW 12 71216057 missense probably damaging 0.98
R7193:2700049A03Rik UTSW 12 71219189 critical splice acceptor site probably null
R7200:2700049A03Rik UTSW 12 71140906 missense probably damaging 0.96
R7488:2700049A03Rik UTSW 12 71150405 missense possibly damaging 0.67
R7755:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
R7757:2700049A03Rik UTSW 12 71189413 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AATGGATGTAGGCCTTCAGTG -3'
(R):5'- TTCATTCTTCAAAATCAAAGCCCAG -3'

Sequencing Primer
(F):5'- AGGCCTTCAGTGATTTGTAATTC -3'
(R):5'- TGCACAGAACATCTATCTATTAAACC -3'
Posted On2019-09-13