Incidental Mutation 'R7360:Slc33a1'
ID571247
Institutional Source Beutler Lab
Gene Symbol Slc33a1
Ensembl Gene ENSMUSG00000027822
Gene Namesolute carrier family 33 (acetyl-CoA transporter), member 1
SynonymsD630022N01Rik, Acatn
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location63933507-63964768 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63947654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 395 (V395A)
Ref Sequence ENSEMBL: ENSMUSP00000029402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029402] [ENSMUST00000160883] [ENSMUST00000161659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029402
AA Change: V395A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029402
Gene: ENSMUSG00000027822
AA Change: V395A

DomainStartEndE-ValueType
Pfam:Acatn 74 292 2.4e-77 PFAM
Pfam:Acatn 282 546 7.1e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000160883
AA Change: V395A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125713
Gene: ENSMUSG00000027822
AA Change: V395A

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161659
AA Change: V395A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123986
Gene: ENSMUSG00000027822
AA Change: V395A

DomainStartEndE-ValueType
Pfam:Acatn 74 290 6e-61 PFAM
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 345 367 N/A INTRINSIC
Pfam:Acatn 374 547 3.7e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is required for the formation of O-acetylated (Ac) gangliosides. The encoded protein is predicted to contain 6 to 10 transmembrane domains, and a leucine zipper motif in transmembrane domain III. Defects in this gene have been reported to cause spastic paraplegia autosomal dominant type 42 (SPG42) in one Chinese family, but not in similar patients of European descent. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a serine to arginine substitution at amino acid 113 show early embryonic growth arrest. Adult heterozygotes display aberrant inflammatory response, increased propensity to infections and malignancies, degenerative features of the PNS and CNS, and abnormal induction of autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
4932415D10Rik T C 10: 82,296,507 D223G unknown Het
Acot11 G C 4: 106,749,351 P534A possibly damaging Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Peli3 A T 19: 4,935,075 M136K possibly damaging Het
Pgm5 A G 19: 24,834,817 I117T probably damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in Slc33a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Slc33a1 APN 3 63964012 missense probably benign
IGL01361:Slc33a1 APN 3 63943412 missense probably damaging 0.96
IGL01564:Slc33a1 APN 3 63943347 missense probably benign 0.01
IGL02027:Slc33a1 APN 3 63948141 missense probably damaging 1.00
IGL02598:Slc33a1 APN 3 63943332 missense probably benign
IGL02877:Slc33a1 APN 3 63943385 missense probably benign
IGL03196:Slc33a1 APN 3 63963730 missense possibly damaging 0.46
IGL03269:Slc33a1 APN 3 63963757 missense probably damaging 0.98
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0973:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R0974:Slc33a1 UTSW 3 63943304 missense probably benign 0.02
R1171:Slc33a1 UTSW 3 63953894 missense probably benign
R1513:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R1618:Slc33a1 UTSW 3 63948229 missense possibly damaging 0.66
R2038:Slc33a1 UTSW 3 63948156 missense probably damaging 1.00
R2095:Slc33a1 UTSW 3 63963955 missense probably damaging 1.00
R3927:Slc33a1 UTSW 3 63963724 missense probably benign 0.19
R5204:Slc33a1 UTSW 3 63963746 missense probably damaging 1.00
R6371:Slc33a1 UTSW 3 63943288 missense probably benign
R6425:Slc33a1 UTSW 3 63964063 missense probably benign
R6641:Slc33a1 UTSW 3 63953906 missense probably benign 0.09
R6709:Slc33a1 UTSW 3 63944701 missense possibly damaging 0.89
R6866:Slc33a1 UTSW 3 63943323 missense probably benign 0.02
R7768:Slc33a1 UTSW 3 63947618 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTAACTCATAGGGAAATCTTCAACTTC -3'
(R):5'- TGAACATCGTCAGTGTCATTTGG -3'

Sequencing Primer
(F):5'- TTCTTCAGGGACTAGAAGACAGCTC -3'
(R):5'- TAGACCAGGTTGGCCTCAGAG -3'
Posted On2019-09-13