Incidental Mutation 'R7360:Acot11'
ID571250
Institutional Source Beutler Lab
Gene Symbol Acot11
Ensembl Gene ENSMUSG00000034853
Gene Nameacyl-CoA thioesterase 11
SynonymsThea, Them1, 2010309H15Rik, 1110020M10Rik, BFIT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location106744555-106804998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 106749351 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 534 (P534A)
Ref Sequence ENSEMBL: ENSMUSP00000069636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047620] [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541]
Predicted Effect probably benign
Transcript: ENSMUST00000047620
SMART Domains Protein: ENSMUSP00000047860
Gene: ENSMUSG00000034871

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:DUF2181 70 310 2.9e-107 PFAM
Pfam:DUF2181 342 579 8e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065253
AA Change: P534A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853
AA Change: P534A

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102762
AA Change: P514A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853
AA Change: P514A

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Meta Mutation Damage Score 0.2031 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null mutation display resistance to high fat diet induced obesity, inflammation and hepatic steatosis, increased energy expenditure, increased brown adipose tissue amount, and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
4932415D10Rik T C 10: 82,296,507 D223G unknown Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Peli3 A T 19: 4,935,075 M136K possibly damaging Het
Pgm5 A G 19: 24,834,817 I117T probably damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc33a1 A G 3: 63,947,654 V395A possibly damaging Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in Acot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Acot11 APN 4 106771484 missense probably benign 0.00
IGL01896:Acot11 APN 4 106771367 missense probably damaging 1.00
IGL02408:Acot11 APN 4 106758381 missense probably damaging 1.00
IGL03053:Acot11 APN 4 106755853 nonsense probably null
IGL03156:Acot11 APN 4 106754136 missense probably damaging 1.00
R0266:Acot11 UTSW 4 106749988 missense probably damaging 0.99
R0485:Acot11 UTSW 4 106762027 missense probably damaging 1.00
R0537:Acot11 UTSW 4 106762455 missense probably benign 0.10
R0707:Acot11 UTSW 4 106760132 missense probably damaging 1.00
R0969:Acot11 UTSW 4 106760080 critical splice donor site probably null
R1109:Acot11 UTSW 4 106749348 missense probably benign 0.01
R1785:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1786:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1965:Acot11 UTSW 4 106749353 missense probably damaging 1.00
R2076:Acot11 UTSW 4 106770713 missense probably damaging 0.99
R2509:Acot11 UTSW 4 106755319 missense possibly damaging 0.90
R4558:Acot11 UTSW 4 106748366 missense probably damaging 1.00
R4565:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4567:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4847:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4881:Acot11 UTSW 4 106755305 critical splice donor site probably null
R5234:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5235:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5409:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5430:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5518:Acot11 UTSW 4 106750010 missense probably benign 0.24
R5763:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5787:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5788:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5933:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5934:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6093:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6104:Acot11 UTSW 4 106755897 missense probably damaging 1.00
R6726:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6727:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6728:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6734:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R7242:Acot11 UTSW 4 106762493 missense probably benign 0.00
R7257:Acot11 UTSW 4 106758402 missense probably damaging 1.00
R8125:Acot11 UTSW 4 106760080 critical splice donor site probably null
R8393:Acot11 UTSW 4 106760193 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCTCTCTGACCACACTCAAG -3'
(R):5'- TACACAGTCCATGGGTTCAC -3'

Sequencing Primer
(F):5'- AGACGAGCTCCTTTCAGACTG -3'
(R):5'- TCCATGGGTTCACAGGGAG -3'
Posted On2019-09-13