Mutagenetix > Incidental Mutation

Incidental Mutation 'R7360:Nphp3'

571268

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 104016078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]

AlphaFold

Q7TNH6

Predicted Effect

probably null
Transcript: ENSMUST00000035167

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193439

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000194774

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,747	R85H	probably benign	Het
4932415D10Rik	T	C	10: 82,296,507	D223G	unknown	Het
Acot11	G	C	4: 106,749,351	P534A	possibly damaging	Het
Arhgef26	T	A	3: 62,448,205	Y733N	possibly damaging	Het
Aste1	G	T	9: 105,397,636	M358I	probably damaging	Het
B4galnt3	C	T	6: 120,232,979	W61*	probably null	Het
Brd9	C	T	13: 73,944,823	R311W	probably benign	Het
Cdkn1c	T	C	7: 143,460,694	D5G	possibly damaging	Het
Cerk	A	G	15: 86,159,126	F158S	probably damaging	Het
Cnot4	T	A	6: 35,065,006	E235V	probably damaging	Het
Crmp1	T	C	5: 37,276,280	V275A	possibly damaging	Het
Dcbld2	C	A	16: 58,465,320		probably null	Het
Dip2a	T	C	10: 76,278,560	R1029G	probably damaging	Het
Dnaaf1	A	G	8: 119,577,351	T43A	probably benign	Het
Eaf2	C	T	16: 36,828,152	S2N	probably benign	Het
Eif2b4	T	C	5: 31,191,375	D164G	probably benign	Het
Fpgs	T	C	2: 32,693,993	Y45C	possibly damaging	Het
Gm1527	C	T	3: 28,914,542	Q248*	probably null	Het
Gm29666	C	T	15: 84,914,268	A31T	unknown	Het
Gmip	C	A	8: 69,811,242	A112D	probably damaging	Het
Hibadh	C	T	6: 52,640,212	G13S	probably benign	Het
Hmcn1	A	T	1: 150,618,846	V4164D	probably damaging	Het
Kif15	A	T	9: 122,991,137	N580I	probably benign	Het
Krt25	G	A	11: 99,317,406	T332M	probably benign	Het
Krt88	G	T	15: 101,447,762		probably benign	Het
Lrrk2	T	C	15: 91,731,655		probably null	Het
Mapkapk5	A	G	5: 121,537,106		probably benign	Het
Myh7b	C	T	2: 155,632,540	S1725L	probably benign	Het
Nckap1l	T	G	15: 103,476,099		probably null	Het
Obscn	A	C	11: 59,082,359	V1996G	probably damaging	Het
Olfr1196	A	T	2: 88,700,987	V114E	probably damaging	Het
Olfr761	T	A	17: 37,953,009	N5I	probably damaging	Het
Parp8	T	C	13: 116,895,771	T289A	probably benign	Het
Pcsk5	T	C	19: 17,515,213	K932R	probably benign	Het
Pde4dip	T	C	3: 97,718,316	D1322G	probably benign	Het
Peli3	A	T	19: 4,935,075	M136K	possibly damaging	Het
Pgm5	A	G	19: 24,834,817	I117T	probably damaging	Het
Ppm1g	T	C	5: 31,203,277	D478G	probably damaging	Het
Ppp2r5c	A	G	12: 110,574,838	T474A	probably benign	Het
Ptger3	T	C	3: 157,567,127	V37A	probably benign	Het
Ptprz1	T	C	6: 23,000,907	S999P	probably damaging	Het
Pygl	C	T	12: 70,227,532	G18S	probably benign	Het
Rest	T	C	5: 77,281,129	V465A	probably benign	Het
Sart1	T	C	19: 5,383,203	D422G	probably damaging	Het
Sgk1	A	G	10: 21,994,073	M4V	probably benign	Het
Slc33a1	A	G	3: 63,947,654	V395A	possibly damaging	Het
Slc38a11	A	T	2: 65,353,795	S171T	possibly damaging	Het
Slc4a2	T	A	5: 24,429,715	S76T	probably benign	Het
Ssc4d	T	A	5: 135,966,111	S184C	probably damaging	Het
Tspoap1	A	G	11: 87,778,521	Y1540C	probably benign	Het
Ube3a	T	A	7: 59,276,635	L408Q	probably damaging	Het
Usp43	C	A	11: 67,876,329		probably null	Het
Zan	A	C	5: 137,386,970	V5067G	unknown	Het
Zfp180	C	A	7: 24,105,490	L445I	probably damaging	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
quartzite	UTSW	9	104036177	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1608:Nphp3	UTSW	9	104035840	missense	probably benign	0.30
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
R9526:Nphp3	UTSW	9	104036138	missense	probably damaging	1.00
R9678:Nphp3	UTSW	9	104023487	missense	possibly damaging	0.90
R9731:Nphp3	UTSW	9	104009170	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCTCTGTGTGACCTGAGGC -3'
(R):5'- CAACAGAAAGATGGCGCTC -3'

Sequencing Primer
(F):5'- ACCTGAGGCAAGTTTCGG -3'
(R):5'- CCTGGGGTACTGTTCTCAAAAATGAC -3'

Posted On

2019-09-13