Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Ptprd'

57127

Institutional Source

Beutler Lab

Gene Symbol

Ptprd

Ensembl Gene

ENSMUSG00000028399

Gene Name

protein tyrosine phosphatase, receptor type, D

Synonyms

1110002J03Rik, 3000002J10Rik, B230219D21Rik

MMRRC Submission

038831-MU

Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75941238-78211961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76084403 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 699 (T699A)

Ref Sequence

ENSEMBL: ENSMUSP00000133328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000173662] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]

AlphaFold

Q64487

Predicted Effect

probably benign
Transcript: ENSMUST00000050757
AA Change: T689A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: T689A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
IGc2	238	299	8.13e-4	SMART
FN3	313	392	7.92e-14	SMART
FN3	408	491	5.73e-11	SMART
IG_like	499	593	8.34e1	SMART
FN3	506	584	9.1e-14	SMART
FN3	597	674	1.21e0	SMART
transmembrane domain	847	869	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000098005
AA Change: T699A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: T699A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	886	897	N/A	INTRINSIC
PTPc	950	1208	6.38e-134	SMART
PTPc	1237	1499	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102834
AA Change: T452A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: T452A

Domain	Start	End	E-Value	Type
IGc2	1	62	8.13e-4	SMART
FN3	76	155	7.92e-14	SMART
FN3	171	254	5.73e-11	SMART
IG_like	262	356	8.34e1	SMART
FN3	269	347	9.1e-14	SMART
FN3	360	437	1.21e0	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	633	645	N/A	INTRINSIC
PTPc	698	956	6.38e-134	SMART
PTPc	985	1247	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107289
AA Change: T1110A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: T1110A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	609	696	2.72e-12	SMART
FN3	712	809	2.87e-11	SMART
FN3	824	904	4.96e-6	SMART
FN3	919	1003	4.12e-12	SMART
FN3	1018	1095	1.95e0	SMART
transmembrane domain	1268	1290	N/A	INTRINSIC
low complexity region	1291	1303	N/A	INTRINSIC
PTPc	1356	1614	6.38e-134	SMART
PTPc	1643	1905	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173376
AA Change: T706A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: T706A

Domain	Start	End	E-Value	Type
IGc2	43	112	8.57e-12	SMART
IGc2	145	221	8.5e-16	SMART
low complexity region	232	244	N/A	INTRINSIC
IGc2	255	316	8.13e-4	SMART
FN3	330	409	7.92e-14	SMART
FN3	425	508	5.73e-11	SMART
IG_like	516	610	8.34e1	SMART
FN3	523	601	9.1e-14	SMART
FN3	614	691	1.21e0	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	887	899	N/A	INTRINSIC
PTPc	952	1210	6.38e-134	SMART
PTPc	1239	1501	9.17e-135	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173560

Predicted Effect

probably benign
Transcript: ENSMUST00000173662
AA Change: T261A

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133832
Gene: ENSMUSG00000028399
AA Change: T261A

Domain	Start	End	E-Value	Type
Blast:FN3	1	54	4e-31	BLAST
SCOP:d1cfb_2	1	66	8e-4	SMART
PDB:2DN7\|A	1	67	7e-17	PDB
FN3	69	153	4.12e-12	SMART
FN3	169	246	1.8e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174023
AA Change: T696A

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: T696A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	211	4.88e-16	SMART
low complexity region	222	234	N/A	INTRINSIC
IGc2	245	306	8.13e-4	SMART
FN3	320	399	7.92e-14	SMART
FN3	415	498	5.73e-11	SMART
IG_like	506	600	8.34e1	SMART
FN3	513	591	9.1e-14	SMART
FN3	604	681	1.21e0	SMART
transmembrane domain	853	875	N/A	INTRINSIC
low complexity region	882	893	N/A	INTRINSIC
PTPc	946	1204	6.38e-134	SMART
PTPc	1233	1495	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174180
AA Change: T1088A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: T1088A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	205	2.09e-15	SMART
IGc2	235	296	8.13e-4	SMART
FN3	310	389	7.92e-14	SMART
FN3	405	488	5.73e-11	SMART
IG_like	496	590	8.34e1	SMART
FN3	503	581	9.1e-14	SMART
FN3	596	683	2.72e-12	SMART
FN3	699	787	6.15e-11	SMART
FN3	802	882	4.96e-6	SMART
FN3	897	981	4.12e-12	SMART
FN3	996	1073	1.95e0	SMART
transmembrane domain	1246	1268	N/A	INTRINSIC
low complexity region	1269	1281	N/A	INTRINSIC
PTPc	1334	1592	6.38e-134	SMART
PTPc	1621	1883	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174531
AA Change: T693A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: T693A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
low complexity region	219	231	N/A	INTRINSIC
IGc2	242	303	8.13e-4	SMART
FN3	317	396	7.92e-14	SMART
FN3	412	495	5.73e-11	SMART
IG_like	503	597	8.34e1	SMART
FN3	510	588	9.1e-14	SMART
FN3	601	678	1.21e0	SMART
transmembrane domain	851	873	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
PTPc	939	1197	6.38e-134	SMART
PTPc	1226	1488	9.17e-135	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174831
AA Change: T699A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: T699A

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212365
AA Change: T19A

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)

Meta Mutation Damage Score

0.0863

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Akap13	C	A	7: 75,747,746	Q2575K	probably damaging	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Dsc1	T	C	18: 20,096,057	Y392C	probably damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mast4	T	C	13: 102,758,744		probably benign	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Sorcs3	C	A	19: 48,206,295	A39E	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het
Zp3	A	G	5: 135,984,356	N181D	possibly damaging	Het

Other mutations in Ptprd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Ptprd	APN	4	75998556	nonsense	probably null
IGL01067:Ptprd	APN	4	76059685	missense	probably damaging	1.00
IGL01121:Ptprd	APN	4	75954201	splice site	probably benign
IGL01531:Ptprd	APN	4	76085520	missense	probably damaging	0.98
IGL01661:Ptprd	APN	4	75954083	missense	probably damaging	1.00
IGL01723:Ptprd	APN	4	76243673	missense	probably damaging	1.00
IGL01735:Ptprd	APN	4	76136820	splice site	probably null
IGL01810:Ptprd	APN	4	76140507	splice site	probably benign
IGL01834:Ptprd	APN	4	76128595	missense	probably damaging	1.00
IGL01835:Ptprd	APN	4	76246821	missense	probably benign	0.02
IGL01867:Ptprd	APN	4	76243647	missense	probably damaging	1.00
IGL02582:Ptprd	APN	4	75947124	missense	probably damaging	1.00
IGL02591:Ptprd	APN	4	75982050	missense	probably damaging	1.00
IGL02741:Ptprd	APN	4	76133284	missense	probably damaging	1.00
IGL02866:Ptprd	APN	4	76050437	missense	probably damaging	1.00
IGL02960:Ptprd	APN	4	76128868	missense	probably damaging	1.00
IGL03155:Ptprd	APN	4	76066219	missense	possibly damaging	0.95
IGL03230:Ptprd	APN	4	76050417	nonsense	probably null
IGL03343:Ptprd	APN	4	76059729	missense	probably damaging	1.00
unhurried	UTSW	4	76100633	nonsense	probably null
ANU22:Ptprd	UTSW	4	76100456	missense	probably damaging	0.99
F5493:Ptprd	UTSW	4	76084408	missense	probably damaging	1.00
P0033:Ptprd	UTSW	4	76128854	nonsense	probably null
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0076:Ptprd	UTSW	4	75947039	splice site	probably benign
R0137:Ptprd	UTSW	4	76136903	missense	probably benign	0.24
R0358:Ptprd	UTSW	4	75944989	missense	probably damaging	1.00
R0365:Ptprd	UTSW	4	76136846	missense	probably damaging	1.00
R0385:Ptprd	UTSW	4	76128665	missense	probably damaging	1.00
R0601:Ptprd	UTSW	4	76100474	missense	probably benign
R0667:Ptprd	UTSW	4	75957346	missense	probably damaging	1.00
R0707:Ptprd	UTSW	4	75957239	missense	probably damaging	1.00
R0734:Ptprd	UTSW	4	76140597	missense	probably damaging	1.00
R0827:Ptprd	UTSW	4	76128915	missense	probably damaging	0.98
R0932:Ptprd	UTSW	4	76136885	missense	probably damaging	1.00
R1069:Ptprd	UTSW	4	75998487	splice site	probably benign
R1069:Ptprd	UTSW	4	76100633	nonsense	probably null
R1086:Ptprd	UTSW	4	76133258	missense	probably damaging	1.00
R1439:Ptprd	UTSW	4	76066200	missense	probably damaging	1.00
R1440:Ptprd	UTSW	4	76084552	missense	probably damaging	0.98
R1688:Ptprd	UTSW	4	75982684	missense	probably damaging	1.00
R1858:Ptprd	UTSW	4	75947147	missense	probably damaging	1.00
R2001:Ptprd	UTSW	4	75954122	missense	probably damaging	1.00
R2020:Ptprd	UTSW	4	76133161	missense	probably damaging	1.00
R2023:Ptprd	UTSW	4	75957104	missense	probably damaging	1.00
R2413:Ptprd	UTSW	4	76133200	missense	probably damaging	1.00
R2510:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R2914:Ptprd	UTSW	4	75947101	missense	probably damaging	1.00
R2971:Ptprd	UTSW	4	76107324	missense	probably benign	0.10
R3051:Ptprd	UTSW	4	76100630	missense	probably damaging	1.00
R3433:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R3964:Ptprd	UTSW	4	76059836	splice site	probably benign
R4009:Ptprd	UTSW	4	75956397	missense	possibly damaging	0.94
R4394:Ptprd	UTSW	4	76128685	missense	probably damaging	1.00
R4420:Ptprd	UTSW	4	76039377	missense	possibly damaging	0.92
R4424:Ptprd	UTSW	4	76102963	missense	probably benign	0.22
R4575:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4578:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4715:Ptprd	UTSW	4	76107333	missense	probably benign	0.03
R4782:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4785:Ptprd	UTSW	4	76140553	missense	probably benign	0.05
R4799:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4944:Ptprd	UTSW	4	76128899	missense	probably damaging	1.00
R4950:Ptprd	UTSW	4	76140515	splice site	probably null
R4969:Ptprd	UTSW	4	76133305	missense	probably damaging	1.00
R5153:Ptprd	UTSW	4	76012102	missense	probably damaging	1.00
R5164:Ptprd	UTSW	4	76100758	splice site	probably null
R5287:Ptprd	UTSW	4	75954168	nonsense	probably null
R5305:Ptprd	UTSW	4	75982626	missense	probably damaging	1.00
R5362:Ptprd	UTSW	4	76128813	missense	probably damaging	1.00
R5403:Ptprd	UTSW	4	75954168	nonsense	probably null
R5531:Ptprd	UTSW	4	76059667	critical splice donor site	probably null
R5543:Ptprd	UTSW	4	76059753	missense	probably damaging	1.00
R5634:Ptprd	UTSW	4	76072018	missense	probably benign	0.01
R5719:Ptprd	UTSW	4	76054602	critical splice acceptor site	probably null
R5884:Ptprd	UTSW	4	75982690	missense	probably damaging	1.00
R6247:Ptprd	UTSW	4	76066291	missense	probably benign	0.06
R6250:Ptprd	UTSW	4	76128995	missense	probably damaging	1.00
R6335:Ptprd	UTSW	4	75954183	missense	probably damaging	1.00
R6352:Ptprd	UTSW	4	76091552	splice site	probably null
R6533:Ptprd	UTSW	4	76128528	missense	probably damaging	1.00
R6756:Ptprd	UTSW	4	75955299	missense	probably damaging	1.00
R6782:Ptprd	UTSW	4	76325140	splice site	probably null
R7131:Ptprd	UTSW	4	76066340	missense	probably damaging	1.00
R7170:Ptprd	UTSW	4	76071962	missense	probably benign	0.06
R7233:Ptprd	UTSW	4	76059783	missense	probably benign	0.00
R7246:Ptprd	UTSW	4	76128676	missense	probably damaging	1.00
R7413:Ptprd	UTSW	4	76246839	missense	probably benign	0.00
R7428:Ptprd	UTSW	4	76086468	missense	probably benign	0.03
R7442:Ptprd	UTSW	4	76059821	nonsense	probably null
R7491:Ptprd	UTSW	4	76133155	missense	probably benign	0.23
R7526:Ptprd	UTSW	4	76066327	missense	probably benign	0.00
R7609:Ptprd	UTSW	4	76072003	missense	probably benign	0.03
R7612:Ptprd	UTSW	4	76086459	missense	probably benign	0.45
R7659:Ptprd	UTSW	4	76128916	missense	probably benign	0.03
R7743:Ptprd	UTSW	4	76086089	missense	probably damaging	1.00
R7748:Ptprd	UTSW	4	76099504	missense	probably null	0.39
R7788:Ptprd	UTSW	4	75998604	missense	probably damaging	1.00
R7836:Ptprd	UTSW	4	75982644	missense	probably damaging	0.99
R7937:Ptprd	UTSW	4	76095535	missense	probably benign	0.00
R8000:Ptprd	UTSW	4	76066242	missense	possibly damaging	0.95
R8018:Ptprd	UTSW	4	76085520	missense	probably damaging	0.98
R8072:Ptprd	UTSW	4	76086036	missense	probably benign	0.01
R8119:Ptprd	UTSW	4	76129026	missense	probably benign	0.00
R8350:Ptprd	UTSW	4	75950661	missense	probably damaging	1.00
R8387:Ptprd	UTSW	4	75955289	missense	probably damaging	1.00
R8458:Ptprd	UTSW	4	76066259	missense	probably benign	0.00
R8529:Ptprd	UTSW	4	76129025	missense	probably damaging	1.00
R8699:Ptprd	UTSW	4	76041392	missense	probably benign
R8924:Ptprd	UTSW	4	75998499	critical splice donor site	probably null
R8984:Ptprd	UTSW	4	75945014	missense	probably damaging	1.00
R9024:Ptprd	UTSW	4	75956330	missense	probably damaging	1.00
R9204:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9206:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9259:Ptprd	UTSW	4	76071963	missense	probably damaging	0.99
R9311:Ptprd	UTSW	4	76133083	missense	probably benign	0.25
R9417:Ptprd	UTSW	4	75947098	missense	probably damaging	0.99
R9427:Ptprd	UTSW	4	76133203	missense	probably benign	0.01
R9579:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9580:Ptprd	UTSW	4	75954078	missense	possibly damaging	0.46
R9701:Ptprd	UTSW	4	75998659	missense	probably damaging	1.00
RF016:Ptprd	UTSW	4	76128655	missense	probably benign	0.01
RF023:Ptprd	UTSW	4	76128565	missense	probably damaging	0.98
Z1176:Ptprd	UTSW	4	76133214	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAGCCTACACAGGAGAATCTTCCAT -3'
(R):5'- TGAGAGGCTGAAAGCAATTTGTGACT -3'

Sequencing Primer
(F):5'- GGAGAATCTTCCATGTTATAGTCAGC -3'
(R):5'- AGCAATTTGTGACTGATTGTATCTC -3'

Posted On

2013-07-11