Incidental Mutation 'R7360:4932415D10Rik'
ID571273
Institutional Source Beutler Lab
Gene Symbol 4932415D10Rik
Ensembl Gene ENSMUSG00000044581
Gene NameRIKEN cDNA 4932415D10 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location82282116-82316582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82296507 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 223 (D223G)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000217661
AA Change: D223G
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
Acot11 G C 4: 106,749,351 P534A possibly damaging Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Peli3 A T 19: 4,935,075 M136K possibly damaging Het
Pgm5 A G 19: 24,834,817 I117T probably damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc33a1 A G 3: 63,947,654 V395A possibly damaging Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in 4932415D10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:4932415D10Rik APN 10 82283752 missense probably benign 0.06
IGL01457:4932415D10Rik APN 10 82284734 missense probably damaging 1.00
IGL01540:4932415D10Rik APN 10 82284182 missense possibly damaging 0.87
IGL02693:4932415D10Rik APN 10 82285258 missense probably benign 0.06
IGL02867:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL02889:4932415D10Rik APN 10 82283820 missense probably damaging 0.96
IGL03080:4932415D10Rik APN 10 82283982 missense probably damaging 0.99
IGL03120:4932415D10Rik APN 10 82285035 missense possibly damaging 0.90
IGL03351:4932415D10Rik APN 10 82283567 utr 3 prime probably benign
FR4449:4932415D10Rik UTSW 10 82285469 frame shift probably null
FR4548:4932415D10Rik UTSW 10 82290996 small insertion probably benign
FR4737:4932415D10Rik UTSW 10 82285469 small deletion probably benign
PIT4480001:4932415D10Rik UTSW 10 82283752 missense probably benign 0.06
R0102:4932415D10Rik UTSW 10 82283556 missense probably damaging 1.00
R0312:4932415D10Rik UTSW 10 82284369 missense probably damaging 1.00
R1303:4932415D10Rik UTSW 10 82284556 missense possibly damaging 0.94
R2039:4932415D10Rik UTSW 10 82284676 missense probably damaging 1.00
R2356:4932415D10Rik UTSW 10 82283955 missense possibly damaging 0.94
R4740:4932415D10Rik UTSW 10 82283647 missense possibly damaging 0.50
R4857:4932415D10Rik UTSW 10 82283848 missense possibly damaging 0.61
R5017:4932415D10Rik UTSW 10 82296676 missense unknown
R5095:4932415D10Rik UTSW 10 82283667 missense probably damaging 1.00
R5209:4932415D10Rik UTSW 10 82283818 missense possibly damaging 0.84
R5388:4932415D10Rik UTSW 10 82283727 missense probably damaging 0.99
R5642:4932415D10Rik UTSW 10 82284483 missense probably damaging 1.00
R5646:4932415D10Rik UTSW 10 82283776 missense probably damaging 0.99
R6188:4932415D10Rik UTSW 10 82285257 missense probably damaging 0.96
R6215:4932415D10Rik UTSW 10 82291112 missense probably benign 0.07
R6252:4932415D10Rik UTSW 10 82283754 missense probably benign 0.30
R6275:4932415D10Rik UTSW 10 82285368 missense probably damaging 1.00
R6303:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6304:4932415D10Rik UTSW 10 82290368 missense possibly damaging 0.79
R6313:4932415D10Rik UTSW 10 82293636 missense probably benign 0.00
R6323:4932415D10Rik UTSW 10 82283082 missense probably benign 0.27
R6374:4932415D10Rik UTSW 10 82288897 unclassified probably benign
R6407:4932415D10Rik UTSW 10 82293811 missense probably benign 0.16
R6468:4932415D10Rik UTSW 10 82295316 missense probably benign 0.01
R6490:4932415D10Rik UTSW 10 82289304 missense possibly damaging 0.90
R6605:4932415D10Rik UTSW 10 82296037 missense probably benign 0.27
R6614:4932415D10Rik UTSW 10 82291648 missense probably benign 0.31
R6626:4932415D10Rik UTSW 10 82292833 missense probably benign 0.03
R6630:4932415D10Rik UTSW 10 82287072 missense possibly damaging 0.81
R6646:4932415D10Rik UTSW 10 82296830 missense unknown
R6723:4932415D10Rik UTSW 10 82289823 missense possibly damaging 0.50
R6751:4932415D10Rik UTSW 10 82283497 missense probably benign 0.06
R6850:4932415D10Rik UTSW 10 82293054 missense possibly damaging 0.68
R6944:4932415D10Rik UTSW 10 82296222 missense probably benign 0.03
R6957:4932415D10Rik UTSW 10 82293786 missense probably benign 0.03
R6988:4932415D10Rik UTSW 10 82291899 missense possibly damaging 0.79
R7069:4932415D10Rik UTSW 10 82289943 missense probably damaging 0.99
R7164:4932415D10Rik UTSW 10 82286229 missense probably damaging 1.00
R7175:4932415D10Rik UTSW 10 82286749 missense probably damaging 1.00
R7201:4932415D10Rik UTSW 10 82291627 missense probably benign 0.03
R7203:4932415D10Rik UTSW 10 82293414 missense probably benign 0.00
R7205:4932415D10Rik UTSW 10 82289327 missense probably benign 0.35
R7241:4932415D10Rik UTSW 10 82287042 missense probably benign 0.01
R7283:4932415D10Rik UTSW 10 82291297 missense possibly damaging 0.90
R7305:4932415D10Rik UTSW 10 82285119 missense probably benign 0.06
R7358:4932415D10Rik UTSW 10 82292013 missense possibly damaging 0.79
R7362:4932415D10Rik UTSW 10 82292997 missense possibly damaging 0.79
R7385:4932415D10Rik UTSW 10 82287737 missense probably benign 0.03
R7385:4932415D10Rik UTSW 10 82287895 missense probably benign 0.05
R7472:4932415D10Rik UTSW 10 82283587 missense probably benign 0.03
R7493:4932415D10Rik UTSW 10 82288964 nonsense probably null
R7493:4932415D10Rik UTSW 10 82316430 missense unknown
R7498:4932415D10Rik UTSW 10 82291279 missense probably benign 0.03
R7512:4932415D10Rik UTSW 10 82292635 missense probably benign 0.31
R7560:4932415D10Rik UTSW 10 82284615 missense probably damaging 1.00
R7591:4932415D10Rik UTSW 10 82292212 missense probably benign 0.16
R7636:4932415D10Rik UTSW 10 82295139 missense probably benign 0.01
R7640:4932415D10Rik UTSW 10 82294656 missense probably damaging 0.99
R7709:4932415D10Rik UTSW 10 82290532 missense possibly damaging 0.81
R7790:4932415D10Rik UTSW 10 82287495 missense probably benign 0.06
RF017:4932415D10Rik UTSW 10 82290992 small insertion probably benign
RF055:4932415D10Rik UTSW 10 82290993 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGGAAGACCTGTGACCC -3'
(R):5'- TCTTTCCTGAAAGTACAACTTGGC -3'

Sequencing Primer
(F):5'- AAGAGGCTTCTTCCTGAATTGC -3'
(R):5'- TCCTGAAAGTACAACTTGGCAAATC -3'
Posted On2019-09-13