Mutagenetix > Incidental Mutation

Incidental Mutation 'R7360:Pygl'

571277

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.305) question?

Stock #

R7360 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70227532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 18 (G18S)

Ref Sequence

ENSEMBL: ENSMUSP00000071231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably benign
Transcript: ENSMUST00000071250
AA Change: G18S

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: G18S

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000161083

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	C	T	6: 129,326,747	R85H	probably benign	Het
4932415D10Rik	T	C	10: 82,296,507	D223G	unknown	Het
Acot11	G	C	4: 106,749,351	P534A	possibly damaging	Het
Arhgef26	T	A	3: 62,448,205	Y733N	possibly damaging	Het
Aste1	G	T	9: 105,397,636	M358I	probably damaging	Het
B4galnt3	C	T	6: 120,232,979	W61*	probably null	Het
Brd9	C	T	13: 73,944,823	R311W	probably benign	Het
Cdkn1c	T	C	7: 143,460,694	D5G	possibly damaging	Het
Cerk	A	G	15: 86,159,126	F158S	probably damaging	Het
Cnot4	T	A	6: 35,065,006	E235V	probably damaging	Het
Crmp1	T	C	5: 37,276,280	V275A	possibly damaging	Het
Dcbld2	C	A	16: 58,465,320		probably null	Het
Dip2a	T	C	10: 76,278,560	R1029G	probably damaging	Het
Dnaaf1	A	G	8: 119,577,351	T43A	probably benign	Het
Eaf2	C	T	16: 36,828,152	S2N	probably benign	Het
Eif2b4	T	C	5: 31,191,375	D164G	probably benign	Het
Fpgs	T	C	2: 32,693,993	Y45C	possibly damaging	Het
Gm1527	C	T	3: 28,914,542	Q248*	probably null	Het
Gm29666	C	T	15: 84,914,268	A31T	unknown	Het
Gmip	C	A	8: 69,811,242	A112D	probably damaging	Het
Hibadh	C	T	6: 52,640,212	G13S	probably benign	Het
Hmcn1	A	T	1: 150,618,846	V4164D	probably damaging	Het
Kif15	A	T	9: 122,991,137	N580I	probably benign	Het
Krt25	G	A	11: 99,317,406	T332M	probably benign	Het
Krt88	G	T	15: 101,447,762		probably benign	Het
Lrrk2	T	C	15: 91,731,655		probably null	Het
Mapkapk5	A	G	5: 121,537,106		probably benign	Het
Myh7b	C	T	2: 155,632,540	S1725L	probably benign	Het
Nckap1l	T	G	15: 103,476,099		probably null	Het
Nphp3	A	G	9: 104,016,078		probably null	Het
Obscn	A	C	11: 59,082,359	V1996G	probably damaging	Het
Olfr1196	A	T	2: 88,700,987	V114E	probably damaging	Het
Olfr761	T	A	17: 37,953,009	N5I	probably damaging	Het
Parp8	T	C	13: 116,895,771	T289A	probably benign	Het
Pcsk5	T	C	19: 17,515,213	K932R	probably benign	Het
Pde4dip	T	C	3: 97,718,316	D1322G	probably benign	Het
Peli3	A	T	19: 4,935,075	M136K	possibly damaging	Het
Pgm5	A	G	19: 24,834,817	I117T	probably damaging	Het
Ppm1g	T	C	5: 31,203,277	D478G	probably damaging	Het
Ppp2r5c	A	G	12: 110,574,838	T474A	probably benign	Het
Ptger3	T	C	3: 157,567,127	V37A	probably benign	Het
Ptprz1	T	C	6: 23,000,907	S999P	probably damaging	Het
Rest	T	C	5: 77,281,129	V465A	probably benign	Het
Sart1	T	C	19: 5,383,203	D422G	probably damaging	Het
Sgk1	A	G	10: 21,994,073	M4V	probably benign	Het
Slc33a1	A	G	3: 63,947,654	V395A	possibly damaging	Het
Slc38a11	A	T	2: 65,353,795	S171T	possibly damaging	Het
Slc4a2	T	A	5: 24,429,715	S76T	probably benign	Het
Ssc4d	T	A	5: 135,966,111	S184C	probably damaging	Het
Tspoap1	A	G	11: 87,778,521	Y1540C	probably benign	Het
Ube3a	T	A	7: 59,276,635	L408Q	probably damaging	Het
Usp43	C	A	11: 67,876,329		probably null	Het
Zan	A	C	5: 137,386,970	V5067G	unknown	Het
Zfp180	C	A	7: 24,105,490	L445I	probably damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGGACACTTGTCGTAGTAGTGC -3'
(R):5'- TTTGCGCACTACGTGACCTG -3'

Sequencing Primer
(F):5'- CTGCTGTGTACGGATCCAG -3'
(R):5'- ACCTGGACGTTCTGGGAG -3'

Posted On

2019-09-13