Incidental Mutation 'R7360:Peli3'
ID571288
Institutional Source Beutler Lab
Gene Symbol Peli3
Ensembl Gene ENSMUSG00000024901
Gene Namepellino 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4930651-4943127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4935075 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 136 (M136K)
Ref Sequence ENSEMBL: ENSMUSP00000025834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025834] [ENSMUST00000120475] [ENSMUST00000133254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025834
AA Change: M136K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025834
Gene: ENSMUSG00000024901
AA Change: M136K

DomainStartEndE-ValueType
Pfam:Pellino 35 445 3.8e-211 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120475
AA Change: M102K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113193
Gene: ENSMUSG00000024901
AA Change: M102K

DomainStartEndE-ValueType
Pfam:Pellino 30 95 1.8e-24 PFAM
Pfam:Pellino 92 411 5.3e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133254
AA Change: M136K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118173
Gene: ENSMUSG00000024901
AA Change: M136K

DomainStartEndE-ValueType
Pfam:Pellino 30 155 3.5e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a scaffold protein and an intermediate signaling protein in the innate immune response pathway. The encoded protein helps transmit the immune response signal from Toll-like receptors to IRAK1/TRAF6 complexes. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null mutation display decreased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
4932415D10Rik T C 10: 82,296,507 D223G unknown Het
Acot11 G C 4: 106,749,351 P534A possibly damaging Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Pgm5 A G 19: 24,834,817 I117T probably damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc33a1 A G 3: 63,947,654 V395A possibly damaging Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in Peli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Peli3 APN 19 4935058 missense probably damaging 0.99
IGL01608:Peli3 APN 19 4932827 missense probably damaging 0.99
IGL03164:Peli3 APN 19 4936116 critical splice donor site probably null
R0540:Peli3 UTSW 19 4941911 start codon destroyed probably null 0.88
R0633:Peli3 UTSW 19 4941782 missense probably damaging 1.00
R4241:Peli3 UTSW 19 4932398 missense probably damaging 0.99
R4578:Peli3 UTSW 19 4934458 missense probably benign 0.00
R4817:Peli3 UTSW 19 4932566 missense probably damaging 1.00
R7718:Peli3 UTSW 19 4934556 critical splice acceptor site probably null
Z1176:Peli3 UTSW 19 4934967 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTCAGCTCTCTGTTGAAGGG -3'
(R):5'- GTTCATACCACAGAGACCTGC -3'

Sequencing Primer
(F):5'- CTCTGTTGAAGGGCTAGCCATAC -3'
(R):5'- GAGACCTGCACGCAAGC -3'
Posted On2019-09-13