Incidental Mutation 'R7360:Pgm5'
ID571291
Institutional Source Beutler Lab
Gene Symbol Pgm5
Ensembl Gene ENSMUSG00000041731
Gene Namephosphoglucomutase 5
Synonyms9530034F03Rik, aciculin
MMRRC Submission
Accession Numbers

Genbank: NM_175013

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location24683016-24861855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24834817 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 117 (I117T)
Ref Sequence ENSEMBL: ENSMUSP00000036025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047666]
Predicted Effect probably damaging
Transcript: ENSMUST00000047666
AA Change: I117T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036025
Gene: ENSMUSG00000041731
AA Change: I117T

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 19 163 3.9e-31 PFAM
Pfam:PGM_PMM_II 198 306 1.8e-15 PFAM
Pfam:PGM_PMM_III 311 425 6.9e-31 PFAM
SCOP:d3pmga4 427 567 5e-74 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoglucomutases (EC 5.2.2.2.), such as PGM5, are phosphotransferases involved in interconversion of glucose-1-phosphate and glucose-6-phosphate. PGM activity is essential in formation of carbohydrates from glucose-6-phosphate and in formation of glucose-6-phosphate from galactose and glycogen (Edwards et al., 1995 [PubMed 8586438]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik C T 6: 129,326,747 R85H probably benign Het
4932415D10Rik T C 10: 82,296,507 D223G unknown Het
Acot11 G C 4: 106,749,351 P534A possibly damaging Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Peli3 A T 19: 4,935,075 M136K possibly damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc33a1 A G 3: 63,947,654 V395A possibly damaging Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in Pgm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Pgm5 APN 19 24834766 missense possibly damaging 0.65
IGL01318:Pgm5 APN 19 24816478 missense probably damaging 1.00
IGL01372:Pgm5 APN 19 24733621 missense probably damaging 1.00
IGL01541:Pgm5 APN 19 24816413 missense probably damaging 1.00
IGL01648:Pgm5 APN 19 24824351 missense probably damaging 0.99
IGL02049:Pgm5 APN 19 24824418 missense probably benign 0.00
IGL02827:Pgm5 APN 19 24709295 missense probably benign 0.16
IGL02975:Pgm5 APN 19 24834848 missense probably benign 0.00
3-1:Pgm5 UTSW 19 24727788 missense probably benign 0.02
P0047:Pgm5 UTSW 19 24816421 missense probably damaging 1.00
PIT4466001:Pgm5 UTSW 19 24824329 missense probably damaging 1.00
R0013:Pgm5 UTSW 19 24733540 critical splice donor site probably null
R0047:Pgm5 UTSW 19 24684556 missense probably damaging 0.98
R0180:Pgm5 UTSW 19 24815763 missense probably damaging 1.00
R0317:Pgm5 UTSW 19 24824399 missense possibly damaging 0.55
R0478:Pgm5 UTSW 19 24834869 missense possibly damaging 0.45
R1587:Pgm5 UTSW 19 24815749 missense probably damaging 1.00
R2017:Pgm5 UTSW 19 24824312 missense probably benign 0.06
R2087:Pgm5 UTSW 19 24733563 missense probably damaging 0.99
R2152:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R2169:Pgm5 UTSW 19 24834815 missense probably damaging 1.00
R3851:Pgm5 UTSW 19 24820203 missense probably damaging 1.00
R4034:Pgm5 UTSW 19 24861657 missense probably damaging 0.96
R4489:Pgm5 UTSW 19 24816445 missense probably benign 0.12
R4630:Pgm5 UTSW 19 24834746 nonsense probably null
R4736:Pgm5 UTSW 19 24834805 missense probably damaging 1.00
R5186:Pgm5 UTSW 19 24820128 missense probably damaging 1.00
R5414:Pgm5 UTSW 19 24709325 missense probably damaging 0.99
R5558:Pgm5 UTSW 19 24824451 splice site probably null
R5617:Pgm5 UTSW 19 24750401 nonsense probably null
R6142:Pgm5 UTSW 19 24824408 missense probably damaging 1.00
R6648:Pgm5 UTSW 19 24861632 missense probably benign 0.02
R6821:Pgm5 UTSW 19 24861647 missense possibly damaging 0.88
R7421:Pgm5 UTSW 19 24709299 missense probably benign 0.03
R7590:Pgm5 UTSW 19 24709265 missense probably damaging 1.00
R7610:Pgm5 UTSW 19 24834756 missense probably damaging 1.00
R7685:Pgm5 UTSW 19 24727851 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTGGAATCATATCGCCTTGGGC -3'
(R):5'- CCGATTCCTTTGGCTAGGAG -3'

Sequencing Primer
(F):5'- GGCATCTCACTGGATTTTTCTGAGC -3'
(R):5'- AATGGCATCTTGTCGACC -3'
Posted On2019-09-13