Mutagenetix > Incidental Mutation

Incidental Mutation 'R7361:Irs1'

571293

Institutional Source

Beutler Lab

Gene Symbol

Irs1

Ensembl Gene

ENSMUSG00000055980

Gene Name

insulin receptor substrate 1

Synonyms

G972R, IRS-1

MMRRC Submission

045447-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.622) question?

Stock #

R7361 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82233101-82291416 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 82289114 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 460 (Y460*)

Ref Sequence

ENSEMBL: ENSMUSP00000063795 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069799]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000069799
AA Change: Y460*

SMART Domains

Protein: ENSMUSP00000063795
Gene: ENSMUSG00000055980
AA Change: Y460*

Domain	Start	End	E-Value	Type
PH	13	117	8.13e-14	SMART
low complexity region	123	143	N/A	INTRINSIC
IRS	155	257	1.19e-35	SMART
PTBI	155	257	7.8e-60	SMART
low complexity region	263	276	N/A	INTRINSIC
low complexity region	378	399	N/A	INTRINSIC
low complexity region	407	419	N/A	INTRINSIC
low complexity region	551	568	N/A	INTRINSIC
low complexity region	662	689	N/A	INTRINSIC
low complexity region	784	794	N/A	INTRINSIC
low complexity region	801	810	N/A	INTRINSIC
low complexity region	824	837	N/A	INTRINSIC
low complexity region	1019	1040	N/A	INTRINSIC
low complexity region	1051	1062	N/A	INTRINSIC
low complexity region	1111	1127	N/A	INTRINSIC
low complexity region	1185	1200	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is phosphorylated by insulin receptor tyrosine kinase. Mutations in this gene are associated with type II diabetes and susceptibility to insulin resistance. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit 50 percent reductions in body weights at birth and at 4 months of age, impaired glucose tolerance, and mild insulin and IGF-1 resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	C	T	6: 132,627,471	V4I	unknown	Het
Actn1	A	T	12: 80,193,715	D199E	probably benign	Het
Adam17	T	C	12: 21,325,601	D739G	probably damaging	Het
Agmat	T	C	4: 141,746,852	S15P	probably benign	Het
Ahsa2	A	G	11: 23,491,099	S229P	probably damaging	Het
Arhgef3	A	G	14: 27,265,578	D36G	possibly damaging	Het
BC055324	A	T	1: 163,986,033	D207E	possibly damaging	Het
C6	C	A	15: 4,796,922	Y662*	probably null	Het
Ccs	T	C	19: 4,833,350	D140G	probably benign	Het
Cdc42bpb	A	G	12: 111,345,605	L65P	probably damaging	Het
Cdh24	A	T	14: 54,638,921	V149E	possibly damaging	Het
Cdk12	C	A	11: 98,210,468	S384*	probably null	Het
Cep350	G	A	1: 155,901,491	A1701V	probably damaging	Het
Ces1g	T	C	8: 93,333,679	Q104R	not run	Het
Chd5	A	G	4: 152,363,288	H537R	probably damaging	Het
Cln5	T	A	14: 103,075,903	V197D	probably damaging	Het
Coq7	A	G	7: 118,529,575	V79A	probably benign	Het
Cp	A	T	3: 19,964,306	N58I	probably benign	Het
Cplx2	A	T	13: 54,378,826	M16L	probably benign	Het
Crot	A	G	5: 8,977,534	L266S	probably damaging	Het
Ctbs	T	A	3: 146,458,754	Y221N	probably damaging	Het
Cul7	T	A	17: 46,657,007	L707Q	probably damaging	Het
D430041D05Rik	G	A	2: 104,255,018	T378I	possibly damaging	Het
Dixdc1	T	C	9: 50,688,653	I364V	probably damaging	Het
Dnah11	T	A	12: 118,018,742	H2564L	probably damaging	Het
Dnajc3	T	C	14: 118,938,164	Y26H	probably benign	Het
Dpysl2	G	A	14: 66,834,215	H159Y	possibly damaging	Het
Ehmt1	T	A	2: 24,856,701	K423I	possibly damaging	Het
Enpp7	A	G	11: 118,992,159	N353S	probably benign	Het
Ext1	G	A	15: 53,344,723	A214V	probably damaging	Het
Fbxo18	A	T	2: 11,747,076	I937N	probably damaging	Het
Fbxo39	T	C	11: 72,316,974	Y51H	possibly damaging	Het
Fry	A	G	5: 150,436,847	H1986R	possibly damaging	Het
Gm2022	A	G	12: 87,895,400	N11D	unknown	Het
Grem2	T	C	1: 174,836,948	K112E	probably benign	Het
Gucy1a1	A	G	3: 82,097,720	V586A	probably damaging	Het
Il12rb2	G	T	6: 67,303,466	L586I	possibly damaging	Het
Il18	T	C	9: 50,579,314	I83T	probably damaging	Het
Jak1	G	T	4: 101,184,339	Q161K	possibly damaging	Het
Jakmip1	T	A	5: 37,118,804	L486Q	probably damaging	Het
Jmjd1c	C	A	10: 67,218,364	Q16K	probably benign	Het
Kidins220	T	C	12: 25,057,000	L1393P	probably benign	Het
Klhl24	A	C	16: 20,118,000	I453L	probably benign	Het
Krtap2-4	C	T	11: 99,614,594	D64N	probably damaging	Het
Man1a	T	A	10: 53,908,009	D592V	probably damaging	Het
Mepe	T	A	5: 104,337,143	Y50N	probably benign	Het
Mier3	G	A	13: 111,705,249	G115S	possibly damaging	Het
Muc4	T	A	16: 32,754,670	S1515T	probably benign	Het
Nalcn	T	C	14: 123,291,839	D1408G	probably benign	Het
Nav1	T	C	1: 135,452,853	M1443V	unknown	Het
Nckap1l	A	C	15: 103,471,282	N332T	possibly damaging	Het
Neurl4	T	A	11: 69,912,079	L1467Q	probably benign	Het
Notch2	A	G	3: 98,131,402	N1287S	probably benign	Het
Nr4a3	C	T	4: 48,083,203	P579S	probably benign	Het
Nrxn2	A	T	19: 6,517,082	H1329L	probably benign	Het
Nynrin	A	T	14: 55,870,400	H988L	possibly damaging	Het
Olfr1183	A	G	2: 88,461,492	T70A	probably benign	Het
Olfr140	A	G	2: 90,051,745	I193T	probably benign	Het
Olfr394	T	A	11: 73,888,001	I124F	probably damaging	Het
Olfr594	G	T	7: 103,220,623	D302Y	possibly damaging	Het
Olfr855	T	A	9: 19,584,560	F8I	probably benign	Het
Pclo	G	A	5: 14,793,868	S1534N	probably damaging	Het
Pign	A	G	1: 105,585,053	V635A	probably benign	Het
Pkhd1	T	C	1: 20,593,953	T134A	probably damaging	Het
Plcb4	A	T	2: 135,976,148	N790I	possibly damaging	Het
Plxna2	G	T	1: 194,799,779	C1453F	probably damaging	Het
Plxna4	A	G	6: 32,196,122		probably null	Het
Pnpla2	A	G	7: 141,457,431	I116V	possibly damaging	Het
Polq	A	G	16: 37,060,428	T985A	probably benign	Het
Ppp1r32	T	G	19: 10,479,579	D134A	probably damaging	Het
Pramef6	T	C	4: 143,895,886	T300A	possibly damaging	Het
Prex1	T	C	2: 166,713,570	N50S	probably benign	Het
Ptgfrn	G	A	3: 101,077,444	A144V	probably benign	Het
Rad54b	G	A	4: 11,599,782	G329S	probably damaging	Het
Rrbp1	A	G	2: 143,967,444	L931S	probably benign	Het
Sipa1l2	A	G	8: 125,453,332	S1109P	probably damaging	Het
Slc26a7	G	T	4: 14,546,305	N341K	probably damaging	Het
Smg1	A	C	7: 118,184,977	D958E	unknown	Het
Smg6	T	A	11: 74,930,153	S417T	probably benign	Het
Srgap3	A	G	6: 112,746,921	V550A	probably damaging	Het
Terb1	T	A	8: 104,468,799	D570V	probably damaging	Het
Tet3	A	G	6: 83,368,094	V1787A	probably benign	Het
Tor1a	A	T	2: 30,963,741	D192E	probably benign	Het
Tpr	T	C	1: 150,447,621	S2379P	possibly damaging	Het
Trip12	A	T	1: 84,750,442	F1138L	probably damaging	Het
Trpv1	T	C	11: 73,260,377	L797P	probably damaging	Het
Tut1	T	C	19: 8,965,334	L595P	probably damaging	Het
Ubl7	T	C	9: 57,914,622	S85P	probably damaging	Het
Urb1	C	A	16: 90,774,768	S1051I	probably damaging	Het
Usp17le	A	G	7: 104,768,877	W353R	probably damaging	Het
Usp44	T	C	10: 93,846,468	L260S	probably benign	Het
Wsb1	T	A	11: 79,240,797		probably null	Het
Xrcc2	A	T	5: 25,692,757	C65S	probably damaging	Het
Zfp316	T	A	5: 143,254,675	M530L	probably benign	Het
Zfp473	T	C	7: 44,733,139	H590R	probably damaging	Het
Zfp983	T	A	17: 21,661,934	H259Q	probably damaging	Het

Other mutations in Irs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Irs1	APN	1	82288483	missense	probably benign	0.01
IGL00534:Irs1	APN	1	82288471	missense	probably benign
IGL01926:Irs1	APN	1	82289959	missense	probably damaging	0.98
IGL02130:Irs1	APN	1	82289467	missense	probably damaging	1.00
IGL03338:Irs1	APN	1	82288401	missense	probably benign	0.05
Hoverboard	UTSW	1	82290098	nonsense	probably null
runt	UTSW	1	82287732	frame shift	probably null
runt2	UTSW	1	82286967	nonsense	probably null
Sprite	UTSW	1	82288109	nonsense	probably null
R0019:Irs1	UTSW	1	82287256	nonsense	probably null
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0063:Irs1	UTSW	1	82288859	missense	probably damaging	1.00
R0318:Irs1	UTSW	1	82288660	missense	probably benign	0.01
R1199:Irs1	UTSW	1	82289626	missense	probably damaging	1.00
R1363:Irs1	UTSW	1	82287288	missense	probably benign	0.02
R1584:Irs1	UTSW	1	82289444	missense	probably benign	0.24
R1874:Irs1	UTSW	1	82289853	frame shift	probably null
R1903:Irs1	UTSW	1	82289461	missense	probably damaging	1.00
R1929:Irs1	UTSW	1	82288459	missense	probably benign
R1986:Irs1	UTSW	1	82288765	missense	probably damaging	1.00
R2136:Irs1	UTSW	1	82290042	missense	probably damaging	1.00
R2179:Irs1	UTSW	1	82290219	missense	possibly damaging	0.81
R2271:Irs1	UTSW	1	82288459	missense	probably benign
R2760:Irs1	UTSW	1	82288570	missense	probably damaging	1.00
R3721:Irs1	UTSW	1	82290085	missense	probably benign	0.11
R3821:Irs1	UTSW	1	82290049	missense	probably benign
R4306:Irs1	UTSW	1	82287964	missense	probably benign	0.11
R4420:Irs1	UTSW	1	82288450	missense	possibly damaging	0.94
R4451:Irs1	UTSW	1	82289028	missense	probably benign	0.00
R4479:Irs1	UTSW	1	82287294	missense	probably damaging	1.00
R4771:Irs1	UTSW	1	82287975	missense	probably benign	0.00
R4782:Irs1	UTSW	1	82287463	missense	probably benign	0.00
R4836:Irs1	UTSW	1	82287732	frame shift	probably null
R4880:Irs1	UTSW	1	82287732	frame shift	probably null
R4881:Irs1	UTSW	1	82287732	frame shift	probably null
R5031:Irs1	UTSW	1	82286967	nonsense	probably null
R5053:Irs1	UTSW	1	82286922	missense	probably benign
R5418:Irs1	UTSW	1	82288770	missense	probably damaging	1.00
R5595:Irs1	UTSW	1	82289925	missense	probably damaging	1.00
R5698:Irs1	UTSW	1	82288734	missense	probably benign	0.01
R6381:Irs1	UTSW	1	82287684	missense	possibly damaging	0.66
R6563:Irs1	UTSW	1	82288407	missense	probably damaging	0.98
R7002:Irs1	UTSW	1	82288260	missense	probably benign	0.13
R7095:Irs1	UTSW	1	82290098	nonsense	probably null
R7195:Irs1	UTSW	1	82287456	missense	probably benign	0.13
R7216:Irs1	UTSW	1	82289755	missense	probably damaging	0.98
R7490:Irs1	UTSW	1	82287264	missense	probably damaging	0.99
R7540:Irs1	UTSW	1	82288002	missense	not run
R7706:Irs1	UTSW	1	82287691	missense	probably damaging	1.00
R7910:Irs1	UTSW	1	82290081	missense	probably benign	0.06
R7912:Irs1	UTSW	1	82289884	missense	probably benign
R7962:Irs1	UTSW	1	82288722	missense	possibly damaging	0.57
R8139:Irs1	UTSW	1	82289739	missense	probably damaging	1.00
R8158:Irs1	UTSW	1	82289533	missense	probably damaging	1.00
R8159:Irs1	UTSW	1	82288569	missense	probably damaging	1.00
R8187:Irs1	UTSW	1	82288300	missense	probably damaging	1.00
R8288:Irs1	UTSW	1	82287961	nonsense	probably null
R8436:Irs1	UTSW	1	82290249	missense	possibly damaging	0.96
R8865:Irs1	UTSW	1	82288109	nonsense	probably null
R8950:Irs1	UTSW	1	82286931	missense	probably benign
R9591:Irs1	UTSW	1	82288248	missense	probably benign	0.00
X0063:Irs1	UTSW	1	82288908	missense	probably damaging	1.00
X0065:Irs1	UTSW	1	82289365	missense	probably damaging	1.00
Z1177:Irs1	UTSW	1	82288996	missense	possibly damaging	0.87
Z1177:Irs1	UTSW	1	82290394	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- GGAGTGAGTTCTCTTTCGAAACC -3'
(R):5'- TAGTAGTACCAGTGGCCATGG -3'

Sequencing Primer
(F):5'- GAAACCGGTTATCCAGATCTGCTG -3'
(R):5'- AGACTGTCTCTTCCCGAGG -3'

Posted On

2019-09-13