Mutagenetix > Incidental Mutation

Incidental Mutation 'R7361:Trip12'

571294

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7361 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 84750442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1138 (F1138L)

Ref Sequence

ENSEMBL: ENSMUSP00000027421 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000189670] [ENSMUST00000189841]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: F1138L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: F1138L

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: F1138L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: F1138L

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: F1105L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: F1105L

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186894

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189670

SMART Domains

Protein: ENSMUSP00000140789
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	138	149	N/A	INTRINSIC
low complexity region	150	167	N/A	INTRINSIC
Blast:HECTc	168	222	5e-8	BLAST
Blast:HECTc	378	434	1e-24	BLAST
HECTc	441	830	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000189841

SMART Domains

Protein: ENSMUSP00000140879
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	1	24	N/A	INTRINSIC
low complexity region	51	63	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	C	T	6: 132,627,471	V4I	unknown	Het
Actn1	A	T	12: 80,193,715	D199E	probably benign	Het
Adam17	T	C	12: 21,325,601	D739G	probably damaging	Het
Agmat	T	C	4: 141,746,852	S15P	probably benign	Het
Ahsa2	A	G	11: 23,491,099	S229P	probably damaging	Het
Arhgef3	A	G	14: 27,265,578	D36G	possibly damaging	Het
BC055324	A	T	1: 163,986,033	D207E	possibly damaging	Het
C6	C	A	15: 4,796,922	Y662*	probably null	Het
Ccs	T	C	19: 4,833,350	D140G	probably benign	Het
Cdc42bpb	A	G	12: 111,345,605	L65P	probably damaging	Het
Cdh24	A	T	14: 54,638,921	V149E	possibly damaging	Het
Cdk12	C	A	11: 98,210,468	S384*	probably null	Het
Cep350	G	A	1: 155,901,491	A1701V	probably damaging	Het
Ces1g	T	C	8: 93,333,679	Q104R	not run	Het
Chd5	A	G	4: 152,363,288	H537R	probably damaging	Het
Cln5	T	A	14: 103,075,903	V197D	probably damaging	Het
Coq7	A	G	7: 118,529,575	V79A	probably benign	Het
Cp	A	T	3: 19,964,306	N58I	probably benign	Het
Cplx2	A	T	13: 54,378,826	M16L	probably benign	Het
Crot	A	G	5: 8,977,534	L266S	probably damaging	Het
Ctbs	T	A	3: 146,458,754	Y221N	probably damaging	Het
Cul7	T	A	17: 46,657,007	L707Q	probably damaging	Het
D430041D05Rik	G	A	2: 104,255,018	T378I	possibly damaging	Het
Dixdc1	T	C	9: 50,688,653	I364V	probably damaging	Het
Dnah11	T	A	12: 118,018,742	H2564L	probably damaging	Het
Dnajc3	T	C	14: 118,938,164	Y26H	probably benign	Het
Dpysl2	G	A	14: 66,834,215	H159Y	possibly damaging	Het
Ehmt1	T	A	2: 24,856,701	K423I	possibly damaging	Het
Enpp7	A	G	11: 118,992,159	N353S	probably benign	Het
Ext1	G	A	15: 53,344,723	A214V	probably damaging	Het
Fbxo18	A	T	2: 11,747,076	I937N	probably damaging	Het
Fbxo39	T	C	11: 72,316,974	Y51H	possibly damaging	Het
Fry	A	G	5: 150,436,847	H1986R	possibly damaging	Het
Gm2022	A	G	12: 87,895,400	N11D	unknown	Het
Grem2	T	C	1: 174,836,948	K112E	probably benign	Het
Gucy1a1	A	G	3: 82,097,720	V586A	probably damaging	Het
Il12rb2	G	T	6: 67,303,466	L586I	possibly damaging	Het
Il18	T	C	9: 50,579,314	I83T	probably damaging	Het
Irs1	A	T	1: 82,289,114	Y460*	probably null	Het
Jak1	G	T	4: 101,184,339	Q161K	possibly damaging	Het
Jakmip1	T	A	5: 37,118,804	L486Q	probably damaging	Het
Jmjd1c	C	A	10: 67,218,364	Q16K	probably benign	Het
Kidins220	T	C	12: 25,057,000	L1393P	probably benign	Het
Klhl24	A	C	16: 20,118,000	I453L	probably benign	Het
Krtap2-4	C	T	11: 99,614,594	D64N	probably damaging	Het
Man1a	T	A	10: 53,908,009	D592V	probably damaging	Het
Mepe	T	A	5: 104,337,143	Y50N	probably benign	Het
Mier3	G	A	13: 111,705,249	G115S	possibly damaging	Het
Muc4	T	A	16: 32,754,670	S1515T	probably benign	Het
Nalcn	T	C	14: 123,291,839	D1408G	probably benign	Het
Nav1	T	C	1: 135,452,853	M1443V	unknown	Het
Nckap1l	A	C	15: 103,471,282	N332T	possibly damaging	Het
Neurl4	T	A	11: 69,912,079	L1467Q	probably benign	Het
Notch2	A	G	3: 98,131,402	N1287S	probably benign	Het
Nr4a3	C	T	4: 48,083,203	P579S	probably benign	Het
Nrxn2	A	T	19: 6,517,082	H1329L	probably benign	Het
Nynrin	A	T	14: 55,870,400	H988L	possibly damaging	Het
Olfr1183	A	G	2: 88,461,492	T70A	probably benign	Het
Olfr140	A	G	2: 90,051,745	I193T	probably benign	Het
Olfr394	T	A	11: 73,888,001	I124F	probably damaging	Het
Olfr594	G	T	7: 103,220,623	D302Y	possibly damaging	Het
Olfr855	T	A	9: 19,584,560	F8I	probably benign	Het
Pclo	G	A	5: 14,793,868	S1534N	probably damaging	Het
Pign	A	G	1: 105,585,053	V635A	probably benign	Het
Pkhd1	T	C	1: 20,593,953	T134A	probably damaging	Het
Plcb4	A	T	2: 135,976,148	N790I	possibly damaging	Het
Plxna2	G	T	1: 194,799,779	C1453F	probably damaging	Het
Plxna4	A	G	6: 32,196,122		probably null	Het
Pnpla2	A	G	7: 141,457,431	I116V	possibly damaging	Het
Polq	A	G	16: 37,060,428	T985A	probably benign	Het
Ppp1r32	T	G	19: 10,479,579	D134A	probably damaging	Het
Pramef6	T	C	4: 143,895,886	T300A	possibly damaging	Het
Prex1	T	C	2: 166,713,570	N50S	probably benign	Het
Ptgfrn	G	A	3: 101,077,444	A144V	probably benign	Het
Rad54b	G	A	4: 11,599,782	G329S	probably damaging	Het
Rrbp1	A	G	2: 143,967,444	L931S	probably benign	Het
Sipa1l2	A	G	8: 125,453,332	S1109P	probably damaging	Het
Slc26a7	G	T	4: 14,546,305	N341K	probably damaging	Het
Smg1	A	C	7: 118,184,977	D958E	unknown	Het
Smg6	T	A	11: 74,930,153	S417T	probably benign	Het
Srgap3	A	G	6: 112,746,921	V550A	probably damaging	Het
Terb1	T	A	8: 104,468,799	D570V	probably damaging	Het
Tet3	A	G	6: 83,368,094	V1787A	probably benign	Het
Tor1a	A	T	2: 30,963,741	D192E	probably benign	Het
Tpr	T	C	1: 150,447,621	S2379P	possibly damaging	Het
Trpv1	T	C	11: 73,260,377	L797P	probably damaging	Het
Tut1	T	C	19: 8,965,334	L595P	probably damaging	Het
Ubl7	T	C	9: 57,914,622	S85P	probably damaging	Het
Urb1	C	A	16: 90,774,768	S1051I	probably damaging	Het
Usp17le	A	G	7: 104,768,877	W353R	probably damaging	Het
Usp44	T	C	10: 93,846,468	L260S	probably benign	Het
Wsb1	T	A	11: 79,240,797		probably null	Het
Xrcc2	A	T	5: 25,692,757	C65S	probably damaging	Het
Zfp316	T	A	5: 143,254,675	M530L	probably benign	Het
Zfp473	T	C	7: 44,733,139	H590R	probably damaging	Het
Zfp983	T	A	17: 21,661,934	H259Q	probably damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGCAAGGTTTCCAGTATGTAC -3'
(R):5'- TCAGCACCGTAACCTTCTGAAATATC -3'

Sequencing Primer
(F):5'- CTGTAGATGATAAATCATGGCAATGG -3'
(R):5'- TTTCCCACCTATCCAGAG -3'

Posted On

2019-09-13