Incidental Mutation 'R7361:Nav1'
ID571296
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135452853 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1443 (M1443V)
Ref Sequence ENSEMBL: ENSMUSP00000140322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably benign
Transcript: ENSMUST00000040599
AA Change: M1503V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: M1503V

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067414
AA Change: M1503V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: M1503V

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189252
Predicted Effect unknown
Transcript: ENSMUST00000190298
AA Change: M1443V
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: M1443V

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
R7601:Nav1 UTSW 1 135460438 missense unknown
R7625:Nav1 UTSW 1 135467745 missense probably damaging 1.00
R7639:Nav1 UTSW 1 135471122 missense probably benign 0.09
R7786:Nav1 UTSW 1 135469995 missense probably damaging 1.00
R7808:Nav1 UTSW 1 135452248 missense unknown
R7815:Nav1 UTSW 1 135584639 missense possibly damaging 0.49
R7825:Nav1 UTSW 1 135450044 missense probably damaging 0.98
R8030:Nav1 UTSW 1 135537239 missense probably damaging 1.00
R8370:Nav1 UTSW 1 135471144 nonsense probably null
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Z1176:Nav1 UTSW 1 135452886 missense unknown
Z1176:Nav1 UTSW 1 135472420 missense probably damaging 1.00
Z1177:Nav1 UTSW 1 135469731 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CAAGCTCCTTCAAGTTCAGAATTTC -3'
(R):5'- AGAAGGATGCACATTGCCTG -3'

Sequencing Primer
(F):5'- TCCTTCAAGTTCAGAATTTCTCAAC -3'
(R):5'- GGATGCACATTGCCTGGTCTTC -3'
Posted On2019-09-13