Incidental Mutation 'R7361:Tpr'
ID571297
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150447621 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2379 (S2379P)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000119161] [ENSMUST00000124484] [ENSMUST00000124973] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000164600]
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111901
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111902
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000119161
AA Change: S2305P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: S2305P

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124484
AA Change: S92P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121991
Gene: ENSMUSG00000006005
AA Change: S92P

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
low complexity region 50 64 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124973
AA Change: S2379P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: S2379P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161611
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164600
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
Pouch UTSW 1 150433772 missense probably damaging 1.00
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 splice site probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7973:Tpr UTSW 1 150403887 missense probably damaging 1.00
R8013:Tpr UTSW 1 150398608 missense probably benign
R8220:Tpr UTSW 1 150432413 missense probably benign 0.05
R8274:Tpr UTSW 1 150423479 splice site probably benign
R8428:Tpr UTSW 1 150414813 missense probably damaging 1.00
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAGTATCCTAGTAAGGGTGTG -3'
(R):5'- TTCTCAGAGACTATCAACAGGAC -3'

Sequencing Primer
(F):5'- GGTCCACCTTACGATTAAAAATAAAC -3'
(R):5'- CCTGACTTTAAGGTGTATGG -3'
Posted On2019-09-13