Incidental Mutation 'R7361:Fbh1'
ID 571302
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission 045447-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R7361 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 11751887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 937 (I937N)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]
AlphaFold Q8K2I9
Predicted Effect probably damaging
Transcript: ENSMUST00000071564
AA Change: I937N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: I937N

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131893
SMART Domains Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594

DomainStartEndE-ValueType
SCOP:d1pjr_1 63 141 5e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,604,434 (GRCm39) V4I unknown Het
Actn1 A T 12: 80,240,489 (GRCm39) D199E probably benign Het
Adam17 T C 12: 21,375,602 (GRCm39) D739G probably damaging Het
Agmat T C 4: 141,474,163 (GRCm39) S15P probably benign Het
Ahsa2 A G 11: 23,441,099 (GRCm39) S229P probably damaging Het
Arhgef3 A G 14: 26,987,535 (GRCm39) D36G possibly damaging Het
C6 C A 15: 4,826,404 (GRCm39) Y662* probably null Het
Ccs T C 19: 4,883,378 (GRCm39) D140G probably benign Het
Cdc42bpb A G 12: 111,312,039 (GRCm39) L65P probably damaging Het
Cdh24 A T 14: 54,876,378 (GRCm39) V149E possibly damaging Het
Cdk12 C A 11: 98,101,294 (GRCm39) S384* probably null Het
Cep350 G A 1: 155,777,237 (GRCm39) A1701V probably damaging Het
Ces1g T C 8: 94,060,307 (GRCm39) Q104R not run Het
Chd5 A G 4: 152,447,745 (GRCm39) H537R probably damaging Het
Cln5 T A 14: 103,313,339 (GRCm39) V197D probably damaging Het
Coq7 A G 7: 118,128,798 (GRCm39) V79A probably benign Het
Cp A T 3: 20,018,470 (GRCm39) N58I probably benign Het
Cplx2 A T 13: 54,526,639 (GRCm39) M16L probably benign Het
Crot A G 5: 9,027,534 (GRCm39) L266S probably damaging Het
Ctbs T A 3: 146,164,509 (GRCm39) Y221N probably damaging Het
Cul7 T A 17: 46,967,933 (GRCm39) L707Q probably damaging Het
D430041D05Rik G A 2: 104,085,363 (GRCm39) T378I possibly damaging Het
Dixdc1 T C 9: 50,599,953 (GRCm39) I364V probably damaging Het
Dnah11 T A 12: 117,982,477 (GRCm39) H2564L probably damaging Het
Dnajc3 T C 14: 119,175,576 (GRCm39) Y26H probably benign Het
Dpysl2 G A 14: 67,071,664 (GRCm39) H159Y possibly damaging Het
Ehmt1 T A 2: 24,746,713 (GRCm39) K423I possibly damaging Het
Eif1ad4 A G 12: 87,862,170 (GRCm39) N11D unknown Het
Enpp7 A G 11: 118,882,985 (GRCm39) N353S probably benign Het
Ext1 G A 15: 53,208,119 (GRCm39) A214V probably damaging Het
Fbxo39 T C 11: 72,207,800 (GRCm39) Y51H possibly damaging Het
Firrm A T 1: 163,813,602 (GRCm39) D207E possibly damaging Het
Fry A G 5: 150,360,312 (GRCm39) H1986R possibly damaging Het
Grem2 T C 1: 174,664,514 (GRCm39) K112E probably benign Het
Gucy1a1 A G 3: 82,005,027 (GRCm39) V586A probably damaging Het
Il12rb2 G T 6: 67,280,450 (GRCm39) L586I possibly damaging Het
Il18 T C 9: 50,490,614 (GRCm39) I83T probably damaging Het
Irs1 A T 1: 82,266,835 (GRCm39) Y460* probably null Het
Jak1 G T 4: 101,041,536 (GRCm39) Q161K possibly damaging Het
Jakmip1 T A 5: 37,276,148 (GRCm39) L486Q probably damaging Het
Jmjd1c C A 10: 67,054,143 (GRCm39) Q16K probably benign Het
Kidins220 T C 12: 25,106,999 (GRCm39) L1393P probably benign Het
Klhl24 A C 16: 19,936,750 (GRCm39) I453L probably benign Het
Krtap2-4 C T 11: 99,505,420 (GRCm39) D64N probably damaging Het
Man1a T A 10: 53,784,105 (GRCm39) D592V probably damaging Het
Mepe T A 5: 104,485,009 (GRCm39) Y50N probably benign Het
Mier3 G A 13: 111,841,783 (GRCm39) G115S possibly damaging Het
Muc4 T A 16: 32,754,670 (GRCm38) S1515T probably benign Het
Nalcn T C 14: 123,529,251 (GRCm39) D1408G probably benign Het
Nav1 T C 1: 135,380,591 (GRCm39) M1443V unknown Het
Nckap1l A C 15: 103,379,709 (GRCm39) N332T possibly damaging Het
Neurl4 T A 11: 69,802,905 (GRCm39) L1467Q probably benign Het
Notch2 A G 3: 98,038,718 (GRCm39) N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 (GRCm39) P579S probably benign Het
Nrxn2 A T 19: 6,567,112 (GRCm39) H1329L probably benign Het
Nynrin A T 14: 56,107,857 (GRCm39) H988L possibly damaging Het
Or1e34 T A 11: 73,778,827 (GRCm39) I124F probably damaging Het
Or4c31 A G 2: 88,291,836 (GRCm39) T70A probably benign Het
Or4c3d A G 2: 89,882,089 (GRCm39) I193T probably benign Het
Or52e3 G T 7: 102,869,830 (GRCm39) D302Y possibly damaging Het
Or7g35 T A 9: 19,495,856 (GRCm39) F8I probably benign Het
Pclo G A 5: 14,843,882 (GRCm39) S1534N probably damaging Het
Pign A G 1: 105,512,778 (GRCm39) V635A probably benign Het
Pkhd1 T C 1: 20,664,177 (GRCm39) T134A probably damaging Het
Plcb4 A T 2: 135,818,068 (GRCm39) N790I possibly damaging Het
Plxna2 G T 1: 194,482,087 (GRCm39) C1453F probably damaging Het
Plxna4 A G 6: 32,173,057 (GRCm39) probably null Het
Pnpla2 A G 7: 141,037,344 (GRCm39) I116V possibly damaging Het
Polq A G 16: 36,880,790 (GRCm39) T985A probably benign Het
Pramel11 T C 4: 143,622,456 (GRCm39) T300A possibly damaging Het
Prex1 T C 2: 166,555,490 (GRCm39) N50S probably benign Het
Ptgfrn G A 3: 100,984,760 (GRCm39) A144V probably benign Het
Rad54b G A 4: 11,599,782 (GRCm39) G329S probably damaging Het
Rrbp1 A G 2: 143,809,364 (GRCm39) L931S probably benign Het
Saxo4 T G 19: 10,456,943 (GRCm39) D134A probably damaging Het
Sipa1l2 A G 8: 126,180,071 (GRCm39) S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 (GRCm39) N341K probably damaging Het
Smg1 A C 7: 117,784,200 (GRCm39) D958E unknown Het
Smg6 T A 11: 74,820,979 (GRCm39) S417T probably benign Het
Srgap3 A G 6: 112,723,882 (GRCm39) V550A probably damaging Het
Terb1 T A 8: 105,195,431 (GRCm39) D570V probably damaging Het
Tet3 A G 6: 83,345,076 (GRCm39) V1787A probably benign Het
Tor1a A T 2: 30,853,753 (GRCm39) D192E probably benign Het
Tpr T C 1: 150,323,372 (GRCm39) S2379P possibly damaging Het
Trip12 A T 1: 84,728,163 (GRCm39) F1138L probably damaging Het
Trpv1 T C 11: 73,151,203 (GRCm39) L797P probably damaging Het
Tut1 T C 19: 8,942,698 (GRCm39) L595P probably damaging Het
Ubl7 T C 9: 57,821,905 (GRCm39) S85P probably damaging Het
Urb1 C A 16: 90,571,656 (GRCm39) S1051I probably damaging Het
Usp17le A G 7: 104,418,084 (GRCm39) W353R probably damaging Het
Usp44 T C 10: 93,682,330 (GRCm39) L260S probably benign Het
Wsb1 T A 11: 79,131,623 (GRCm39) probably null Het
Xrcc2 A T 5: 25,897,755 (GRCm39) C65S probably damaging Het
Zfp316 T A 5: 143,240,430 (GRCm39) M530L probably benign Het
Zfp473 T C 7: 44,382,563 (GRCm39) H590R probably damaging Het
Zfp983 T A 17: 21,880,850 (GRCm39) H259Q probably damaging Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R0972:Fbh1 UTSW 2 11,768,899 (GRCm39) splice site probably benign
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7460:Fbh1 UTSW 2 11,761,496 (GRCm39) missense probably benign 0.38
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8000:Fbh1 UTSW 2 11,772,100 (GRCm39) missense probably benign 0.21
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R8883:Fbh1 UTSW 2 11,753,922 (GRCm39) missense probably benign 0.21
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9306:Fbh1 UTSW 2 11,772,387 (GRCm39) missense probably benign 0.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTTCAGGAACCTTGCCTC -3'
(R):5'- TACACAGCTAGCAAACAGTGAG -3'

Sequencing Primer
(F):5'- GGCTGGCCTCAAATTCATAGAGATC -3'
(R):5'- CTAGCAAACAGTGAGAGGTTTATAAG -3'
Posted On 2019-09-13