Incidental Mutation 'R7361:Slc26a7'
ID571317
Institutional Source Beutler Lab
Gene Symbol Slc26a7
Ensembl Gene ENSMUSG00000040569
Gene Namesolute carrier family 26, member 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location14502430-14621805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 14546305 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 341 (N341K)
Ref Sequence ENSEMBL: ENSMUSP00000041789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042221]
Predicted Effect probably damaging
Transcript: ENSMUST00000042221
AA Change: N341K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041789
Gene: ENSMUSG00000040569
AA Change: N341K

DomainStartEndE-ValueType
Pfam:Sulfate_transp 47 444 6.9e-95 PFAM
transmembrane domain 445 467 N/A INTRINSIC
Pfam:STAS 493 637 4.7e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of sulfate/anion transporter genes. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. This gene has abundant and specific expression in the kidney. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice deficient for this marker have a reduce arterial pH and reduced serum bicarbonate. Urine is more concentrated and has an elevated pH. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Slc26a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Slc26a7 APN 4 14548403 splice site probably benign
IGL00943:Slc26a7 APN 4 14506477 missense probably benign 0.01
IGL01878:Slc26a7 APN 4 14519388 splice site probably null
IGL02698:Slc26a7 APN 4 14593867 missense possibly damaging 0.93
IGL03133:Slc26a7 APN 4 14532576 missense possibly damaging 0.49
R0200:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0240:Slc26a7 UTSW 4 14532651 missense probably damaging 1.00
R0608:Slc26a7 UTSW 4 14621317 missense probably benign 0.04
R0833:Slc26a7 UTSW 4 14593873 missense probably damaging 1.00
R1496:Slc26a7 UTSW 4 14506489 missense probably benign 0.01
R1592:Slc26a7 UTSW 4 14552470 missense probably benign 0.09
R1656:Slc26a7 UTSW 4 14621221 missense possibly damaging 0.90
R1758:Slc26a7 UTSW 4 14548491 missense possibly damaging 0.58
R1861:Slc26a7 UTSW 4 14522873 missense probably benign
R2429:Slc26a7 UTSW 4 14506399 splice site probably benign
R2850:Slc26a7 UTSW 4 14593806 splice site probably benign
R3442:Slc26a7 UTSW 4 14565511 missense probably benign 0.11
R4158:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4160:Slc26a7 UTSW 4 14544197 missense probably benign 0.38
R4721:Slc26a7 UTSW 4 14510261 splice site probably null
R4727:Slc26a7 UTSW 4 14590477 missense probably damaging 1.00
R4825:Slc26a7 UTSW 4 14546309 missense probably benign 0.18
R4992:Slc26a7 UTSW 4 14565508 missense probably damaging 1.00
R5024:Slc26a7 UTSW 4 14532572 missense possibly damaging 0.91
R5344:Slc26a7 UTSW 4 14519402 missense probably benign 0.00
R5373:Slc26a7 UTSW 4 14546447 missense probably damaging 0.99
R5540:Slc26a7 UTSW 4 14506621 missense probably benign
R6046:Slc26a7 UTSW 4 14505471 missense probably benign 0.24
R6320:Slc26a7 UTSW 4 14524498 missense probably benign 0.01
R6685:Slc26a7 UTSW 4 14593819 missense probably damaging 1.00
R6685:Slc26a7 UTSW 4 14593820 missense probably damaging 1.00
R6880:Slc26a7 UTSW 4 14516159 missense possibly damaging 0.57
R6958:Slc26a7 UTSW 4 14506442 missense probably benign 0.00
R7000:Slc26a7 UTSW 4 14552476 missense probably benign
R7090:Slc26a7 UTSW 4 14565460 nonsense probably null
R7122:Slc26a7 UTSW 4 14533639 missense probably damaging 1.00
R8035:Slc26a7 UTSW 4 14621338 missense possibly damaging 0.46
R8252:Slc26a7 UTSW 4 14621415 start gained probably benign
R8262:Slc26a7 UTSW 4 14621269 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTATACTCTGTGAAAGCTAGGTTC -3'
(R):5'- GCAGGAGATTTCATGGCAAG -3'

Sequencing Primer
(F):5'- CTAAGCTTCCTGTGAGTGACTCAGAG -3'
(R):5'- TGCTCCCCCAATGAACAT -3'
Posted On2019-09-13