Incidental Mutation 'R0646:Kpna6'
ID57133
Institutional Source Beutler Lab
Gene Symbol Kpna6
Ensembl Gene ENSMUSG00000003731
Gene Namekaryopherin (importin) alpha 6
SynonymsIPOA7, NPI-2
MMRRC Submission 038831-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0646 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129643980-129672767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129650790 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 380 (F380I)
Ref Sequence ENSEMBL: ENSMUSP00000099650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003828] [ENSMUST00000102590]
Predicted Effect probably benign
Transcript: ENSMUST00000003828
AA Change: F377I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000003828
Gene: ENSMUSG00000003731
AA Change: F377I

DomainStartEndE-ValueType
Pfam:IBB 2 100 9.5e-28 PFAM
ARM 109 151 2.46e-4 SMART
ARM 153 193 6.73e-11 SMART
ARM 195 236 3.19e-3 SMART
ARM 239 278 6.64e-1 SMART
ARM 280 320 1.16e-5 SMART
ARM 322 362 1.98e-8 SMART
ARM 364 404 6.68e-6 SMART
ARM 407 447 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102590
AA Change: F380I

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099650
Gene: ENSMUSG00000003731
AA Change: F380I

DomainStartEndE-ValueType
Pfam:IBB 9 102 4.4e-27 PFAM
ARM 112 154 2.46e-4 SMART
ARM 156 196 6.73e-11 SMART
ARM 198 239 3.19e-3 SMART
ARM 242 281 6.64e-1 SMART
ARM 283 323 1.16e-5 SMART
ARM 325 365 1.98e-8 SMART
ARM 367 407 6.68e-6 SMART
ARM 410 450 1.89e-5 SMART
Pfam:Arm_3 464 514 5.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138916
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146215
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. The protein encoded by this gene is a member of the importin alpha family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null mutation are infertile and show a block in zygotic genome activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik C T 11: 23,575,491 R716H probably damaging Het
4930432E11Rik C T 7: 29,561,285 noncoding transcript Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Abcb11 A G 2: 69,285,283 I579T probably damaging Het
Abcc9 T C 6: 142,682,104 N400S probably benign Het
Adarb2 T C 13: 8,731,819 L577P probably damaging Het
Agt A C 8: 124,557,113 N422K probably damaging Het
Ahnak A T 19: 9,013,402 K4017* probably null Het
Akap13 C A 7: 75,747,746 Q2575K probably damaging Het
Aldh3a2 A T 11: 61,253,715 I339K probably damaging Het
Alox15 G T 11: 70,345,624 Y483* probably null Het
Ampd1 A T 3: 103,099,597 I713F probably damaging Het
Amph A T 13: 19,113,116 E344V possibly damaging Het
Arid5b A G 10: 68,096,977 S1032P probably damaging Het
Armc8 C A 9: 99,505,688 L393F probably damaging Het
Bpnt1 A G 1: 185,345,426 probably null Het
Cachd1 G A 4: 100,988,221 R970H probably damaging Het
Cd207 T C 6: 83,675,756 T131A probably benign Het
Cd83 G A 13: 43,797,533 V54I probably benign Het
Cfap43 T C 19: 47,763,676 K1086E probably benign Het
Cfap65 A T 1: 74,902,169 V1837E probably benign Het
Clcnka T A 4: 141,396,606 H89L probably benign Het
Cnga4 T C 7: 105,404,975 I50T possibly damaging Het
Cog5 A G 12: 31,837,359 probably benign Het
Col11a2 T A 17: 34,059,348 probably null Het
Col28a1 T G 6: 8,175,291 I186L possibly damaging Het
Col4a2 T A 8: 11,431,252 M808K probably benign Het
Copb2 A G 9: 98,563,475 probably benign Het
Dbnl G A 11: 5,795,441 probably benign Het
Dbx2 T C 15: 95,654,612 T51A possibly damaging Het
Dcp1a A T 14: 30,502,885 M123L probably damaging Het
Ddx42 T A 11: 106,232,833 F217I probably benign Het
Dlc1 T C 8: 36,858,051 T367A probably benign Het
Dmgdh A T 13: 93,752,355 T834S probably benign Het
Dnah8 T C 17: 30,684,173 S929P probably damaging Het
Dnase1l2 C A 17: 24,441,082 V271L possibly damaging Het
Dsc1 T C 18: 20,096,057 Y392C probably damaging Het
Edn1 T C 13: 42,305,242 probably benign Het
Eps8l3 T C 3: 107,884,810 L351P probably damaging Het
F12 G A 13: 55,422,483 probably benign Het
Fam47e T C 5: 92,578,458 probably benign Het
Fcrl5 C A 3: 87,442,013 Q32K probably benign Het
Fndc1 C T 17: 7,741,673 V1637I possibly damaging Het
Foxg1 G T 12: 49,384,567 probably benign Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Galnt5 A T 2: 57,999,085 K232N probably benign Het
Ggt5 G A 10: 75,602,648 V68M probably damaging Het
Gm11639 G A 11: 104,720,501 D390N probably benign Het
Gm13084 A C 4: 143,812,585 S113A possibly damaging Het
Gm16519 T C 17: 70,929,106 C17R probably benign Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gm884 T A 11: 103,613,160 K485* probably null Het
Gm9631 T G 11: 121,945,629 D28A probably damaging Het
Gpx2 T C 12: 76,795,313 I21M probably benign Het
H2-Q2 T G 17: 35,345,685 D354E probably damaging Het
Icam2 A T 11: 106,380,891 I71K probably damaging Het
Il12a T C 3: 68,697,890 probably benign Het
Insm2 C G 12: 55,600,440 A323G probably benign Het
Itga1 T C 13: 114,968,299 T1064A probably benign Het
Itgad T A 7: 128,174,004 V11E possibly damaging Het
Kctd15 C T 7: 34,644,881 S115N probably damaging Het
Klra5 A G 6: 129,903,564 W124R probably damaging Het
Kng2 T A 16: 22,987,736 D571V probably benign Het
Lipo1 A T 19: 33,784,769 Y109* probably null Het
Man2a2 T C 7: 80,363,197 H540R possibly damaging Het
Map2k4 T C 11: 65,712,275 E188G probably damaging Het
Mast4 T C 13: 102,758,744 probably benign Het
Mbtd1 A G 11: 93,905,212 D25G probably damaging Het
Med13 T A 11: 86,331,089 Q238L possibly damaging Het
Mmachc A G 4: 116,703,654 Y215H probably damaging Het
Mtor T A 4: 148,484,354 Y1110* probably null Het
Nek2 A G 1: 191,822,219 N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,515,693 probably null Het
Neo1 G T 9: 58,931,034 T489K probably damaging Het
Neu1 T A 17: 34,934,760 Y387N probably damaging Het
Nfasc A T 1: 132,608,438 C586* probably null Het
Nle1 G A 11: 82,904,845 L259F probably damaging Het
Nrde2 G A 12: 100,143,846 Q309* probably null Het
Nufip2 C T 11: 77,686,453 H76Y probably benign Het
Olfr1330 A C 4: 118,893,490 T136P probably damaging Het
Olfr1383 A T 11: 49,524,578 N285I probably damaging Het
Olfr466 A T 13: 65,153,063 I280F probably damaging Het
Olfr584 T C 7: 103,086,151 F206S probably damaging Het
Olfr670 A T 7: 104,959,811 I307N probably benign Het
Olfr731 A T 14: 50,238,639 I82N probably damaging Het
Pcdhb5 A G 18: 37,321,622 T352A probably benign Het
Pcdhb7 A T 18: 37,343,389 D526V probably damaging Het
Phkg1 A T 5: 129,864,553 probably null Het
Plg C T 17: 12,418,736 T744M probably damaging Het
Plxnd1 A C 6: 115,958,699 probably benign Het
Poglut1 A T 16: 38,529,475 I312N probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppt1 A G 4: 122,844,099 M77V probably benign Het
Pramel5 G T 4: 144,271,620 T351N probably damaging Het
Psmb4 G A 3: 94,884,964 R216C probably benign Het
Ptprd T C 4: 76,084,403 T699A probably damaging Het
Retreg3 A T 11: 101,098,629 probably benign Het
Scaper G A 9: 55,758,056 A389V probably damaging Het
Serinc5 G A 13: 92,688,737 D225N possibly damaging Het
Slco1a1 T G 6: 141,925,754 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sod3 A T 5: 52,368,079 D40V probably benign Het
Sorcs3 C A 19: 48,206,295 A39E probably benign Het
Spon1 A T 7: 114,039,821 T761S probably benign Het
Syde2 A G 3: 146,014,249 probably null Het
Synm T A 7: 67,759,168 D154V probably benign Het
Synpo2 T C 3: 123,114,449 E406G probably damaging Het
Tcea3 T A 4: 136,248,071 L8* probably null Het
Tec G A 5: 72,823,497 L33F probably damaging Het
Tex15 T A 8: 33,582,326 S2634T possibly damaging Het
Tg T A 15: 66,729,626 Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 V853I probably benign Het
Togaram1 A G 12: 65,021,466 K1748E probably damaging Het
Ttn T C 2: 76,898,478 probably benign Het
Usp36 C T 11: 118,273,021 D234N probably damaging Het
Usp40 G A 1: 87,978,522 P664S probably benign Het
Vmn1r54 T A 6: 90,269,653 L183H probably benign Het
Vmn1r58 T G 7: 5,410,677 I185L probably benign Het
Wnt8a A T 18: 34,547,565 R328W probably benign Het
Yars A G 4: 129,213,939 probably benign Het
Zbtb49 A C 5: 38,200,674 M745R probably damaging Het
Zeb1 T G 18: 5,759,027 F162V probably damaging Het
Zfp369 A T 13: 65,297,548 H835L probably damaging Het
Zic5 A G 14: 122,463,939 V460A unknown Het
Zp3 A G 5: 135,984,356 N181D possibly damaging Het
Other mutations in Kpna6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Kpna6 APN 4 129655483 missense probably damaging 1.00
IGL02750:Kpna6 APN 4 129661377 missense probably damaging 1.00
IGL02904:Kpna6 APN 4 129650687 missense probably benign 0.24
IGL02998:Kpna6 APN 4 129655504 missense probably benign 0.00
IGL03370:Kpna6 APN 4 129655521 missense probably damaging 1.00
krazy_eight UTSW 4 129655428 critical splice donor site probably null
magnificent_seven UTSW 4 129649306 nonsense probably null
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0054:Kpna6 UTSW 4 129657458 missense probably benign 0.01
R0305:Kpna6 UTSW 4 129649249 missense probably benign 0.00
R0390:Kpna6 UTSW 4 129657804 missense possibly damaging 0.61
R0623:Kpna6 UTSW 4 129655416 unclassified probably benign
R1067:Kpna6 UTSW 4 129648103 missense probably benign 0.39
R1348:Kpna6 UTSW 4 129661359 nonsense probably null
R1661:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1665:Kpna6 UTSW 4 129657471 missense probably benign 0.10
R1766:Kpna6 UTSW 4 129657442 missense probably benign 0.33
R4833:Kpna6 UTSW 4 129657779 missense possibly damaging 0.51
R4941:Kpna6 UTSW 4 129648032 missense probably damaging 1.00
R4974:Kpna6 UTSW 4 129656405 splice site probably null
R5244:Kpna6 UTSW 4 129655428 critical splice donor site probably null
R5914:Kpna6 UTSW 4 129672692 unclassified probably benign
R6148:Kpna6 UTSW 4 129649306 nonsense probably null
R6713:Kpna6 UTSW 4 129653984 missense probably damaging 1.00
R6799:Kpna6 UTSW 4 129657454 missense probably damaging 0.99
R6942:Kpna6 UTSW 4 129651721 splice site probably null
R7073:Kpna6 UTSW 4 129654346 missense probably damaging 1.00
R7794:Kpna6 UTSW 4 129648051 missense probably benign
R7815:Kpna6 UTSW 4 129657797 missense probably benign
Z1176:Kpna6 UTSW 4 129648078 missense not run
Z1176:Kpna6 UTSW 4 129655548 missense not run
Predicted Primers PCR Primer
(F):5'- ACAGGAGAGCGAGCACACATTC -3'
(R):5'- CACCTTCTCTAGTGAGAGCAAAGAACC -3'

Sequencing Primer
(F):5'- CACATTCTCATTTAAGACGCGAG -3'
(R):5'- atccgcccatctctgcc -3'
Posted On2013-07-11