Incidental Mutation 'R7361:Zfp473'
ID571335
Institutional Source Beutler Lab
Gene Symbol Zfp473
Ensembl Gene ENSMUSG00000048012
Gene Namezinc finger protein 473
SynonymsD030014N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location44731480-44751050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44733139 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 590 (H590R)
Ref Sequence ENSEMBL: ENSMUSP00000051069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060270] [ENSMUST00000118162] [ENSMUST00000120074] [ENSMUST00000120798] [ENSMUST00000126366] [ENSMUST00000140599] [ENSMUST00000149011]
Predicted Effect probably damaging
Transcript: ENSMUST00000060270
AA Change: H590R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051069
Gene: ENSMUSG00000048012
AA Change: H590R

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118162
AA Change: H589R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113316
Gene: ENSMUSG00000048012
AA Change: H589R

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120074
AA Change: H590R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113774
Gene: ENSMUSG00000048012
AA Change: H590R

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
ZnF_C2H2 209 231 1.18e-2 SMART
ZnF_C2H2 265 287 8.47e-4 SMART
ZnF_C2H2 377 399 2.4e-3 SMART
ZnF_C2H2 404 426 8.31e0 SMART
ZnF_C2H2 432 454 1.64e-1 SMART
ZnF_C2H2 460 482 1.98e-4 SMART
ZnF_C2H2 488 510 3.44e-4 SMART
ZnF_C2H2 516 538 2.57e-3 SMART
ZnF_C2H2 544 566 3.29e-1 SMART
ZnF_C2H2 572 594 2.29e0 SMART
ZnF_C2H2 697 719 1.47e1 SMART
ZnF_C2H2 725 747 1.04e-3 SMART
ZnF_C2H2 753 775 3.39e-3 SMART
ZnF_C2H2 781 803 2.24e-3 SMART
ZnF_C2H2 809 831 5.99e-4 SMART
ZnF_C2H2 837 859 1.36e-2 SMART
ZnF_C2H2 865 887 2.57e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120798
AA Change: H589R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113789
Gene: ENSMUSG00000048012
AA Change: H589R

DomainStartEndE-ValueType
KRAB 23 83 7.75e-3 SMART
ZnF_C2H2 208 230 1.18e-2 SMART
ZnF_C2H2 264 286 8.47e-4 SMART
ZnF_C2H2 376 398 2.4e-3 SMART
ZnF_C2H2 403 425 8.31e0 SMART
ZnF_C2H2 431 453 1.64e-1 SMART
ZnF_C2H2 459 481 1.98e-4 SMART
ZnF_C2H2 487 509 3.44e-4 SMART
ZnF_C2H2 515 537 2.57e-3 SMART
ZnF_C2H2 543 565 3.29e-1 SMART
ZnF_C2H2 571 593 2.29e0 SMART
ZnF_C2H2 696 718 1.47e1 SMART
ZnF_C2H2 724 746 1.04e-3 SMART
ZnF_C2H2 752 774 3.39e-3 SMART
ZnF_C2H2 780 802 2.24e-3 SMART
ZnF_C2H2 808 830 5.99e-4 SMART
ZnF_C2H2 836 858 1.36e-2 SMART
ZnF_C2H2 864 886 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126366
SMART Domains Protein: ENSMUSP00000127101
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140599
SMART Domains Protein: ENSMUSP00000127738
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149011
SMART Domains Protein: ENSMUSP00000130689
Gene: ENSMUSG00000048012

DomainStartEndE-ValueType
KRAB 23 84 8.77e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Krueppel C2H2-type zinc-finger family of proteins. The encoded protein, a component of the U7 snRNP complex, plays a role in histone 3'-end pre-mRNA processing and may be required for cell cycle progression to S phase. Expression level and methylation status of this gene may be correlated with bone mineral density. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Zfp473
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Zfp473 APN 7 44734568 missense probably damaging 1.00
IGL01443:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01459:Zfp473 APN 7 44739563 missense probably damaging 0.99
IGL01905:Zfp473 APN 7 44733727 missense probably benign 0.00
IGL02027:Zfp473 APN 7 44738038 splice site probably benign
IGL02314:Zfp473 APN 7 44733929 missense probably benign 0.00
IGL02445:Zfp473 APN 7 44733683 missense probably damaging 1.00
IGL03033:Zfp473 APN 7 44733098 missense probably benign 0.05
R0037:Zfp473 UTSW 7 44733900 missense probably damaging 0.96
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0054:Zfp473 UTSW 7 44734475 missense probably damaging 0.99
R0190:Zfp473 UTSW 7 44733188 missense probably damaging 1.00
R1178:Zfp473 UTSW 7 44734594 missense probably benign 0.00
R1387:Zfp473 UTSW 7 44732941 missense probably benign 0.00
R2141:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R2142:Zfp473 UTSW 7 44733077 missense possibly damaging 0.57
R4194:Zfp473 UTSW 7 44732252 missense probably benign 0.08
R4453:Zfp473 UTSW 7 44733254 missense probably damaging 0.99
R4585:Zfp473 UTSW 7 44732952 nonsense probably null
R4586:Zfp473 UTSW 7 44732952 nonsense probably null
R4945:Zfp473 UTSW 7 44734564 missense probably benign 0.00
R5072:Zfp473 UTSW 7 44732519 missense probably damaging 0.98
R5429:Zfp473 UTSW 7 44732848 missense possibly damaging 0.69
R5464:Zfp473 UTSW 7 44732638 missense probably damaging 1.00
R5551:Zfp473 UTSW 7 44734151 missense probably benign 0.03
R5618:Zfp473 UTSW 7 44741732 missense probably benign 0.08
R5985:Zfp473 UTSW 7 44733328 missense probably damaging 1.00
R6288:Zfp473 UTSW 7 44733534 missense probably damaging 1.00
R6701:Zfp473 UTSW 7 44732794 missense possibly damaging 0.58
R7069:Zfp473 UTSW 7 44732374 missense probably damaging 1.00
R7284:Zfp473 UTSW 7 44733203 missense not run
R7495:Zfp473 UTSW 7 44737944 missense probably benign 0.04
R7631:Zfp473 UTSW 7 44733704 missense possibly damaging 0.62
R7940:Zfp473 UTSW 7 44734576 missense probably damaging 1.00
R7957:Zfp473 UTSW 7 44732492 missense probably damaging 1.00
X0027:Zfp473 UTSW 7 44733418 missense probably damaging 1.00
Z1177:Zfp473 UTSW 7 44732308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCATAGGTTTCCCCAC -3'
(R):5'- TGCCAGGACTTTTAACCGAC -3'

Sequencing Primer
(F):5'- ACATGGGTCACACTCACCGG -3'
(R):5'- ACACTTAGTTCGACACCGGCTG -3'
Posted On2019-09-13