Incidental Mutation 'R7361:Neurl4'
ID571352
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69912079 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1467 (L1467Q)
Ref Sequence ENSEMBL: ENSMUSP00000135277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043419] [ENSMUST00000057884] [ENSMUST00000061837] [ENSMUST00000070996] [ENSMUST00000071026] [ENSMUST00000072581] [ENSMUST00000108609] [ENSMUST00000108610] [ENSMUST00000108611] [ENSMUST00000108612] [ENSMUST00000108613] [ENSMUST00000108617] [ENSMUST00000177138] [ENSMUST00000116358] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000134581] [ENSMUST00000164359] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000043419
SMART Domains Protein: ENSMUSP00000047008
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
eIF-5a 83 150 2.43e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057884
SMART Domains Protein: ENSMUSP00000054072
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
Pfam:G_path_suppress 5 294 6.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
AA Change: L1491Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: L1491Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070996
SMART Domains Protein: ENSMUSP00000067077
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071026
SMART Domains Protein: ENSMUSP00000068651
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072581
SMART Domains Protein: ENSMUSP00000072389
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108609
SMART Domains Protein: ENSMUSP00000104249
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108610
SMART Domains Protein: ENSMUSP00000104250
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108611
SMART Domains Protein: ENSMUSP00000104251
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108612
SMART Domains Protein: ENSMUSP00000104252
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108613
SMART Domains Protein: ENSMUSP00000104253
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108617
AA Change: L1469Q

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: L1469Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177138
AA Change: L1467Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: L1467Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116358
SMART Domains Protein: ENSMUSP00000112062
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284
AA Change: L198Q

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134581
Predicted Effect probably benign
Transcript: ENSMUST00000164359
SMART Domains Protein: ENSMUSP00000132717
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177476
AA Change: L1489Q

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: L1489Q

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0421:Neurl4 UTSW 11 69908534 missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1536:Neurl4 UTSW 11 69903426 nonsense probably null
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1857:Neurl4 UTSW 11 69905535 missense probably damaging 1.00
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69904033 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R6791:Neurl4 UTSW 11 69908510 missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
R7367:Neurl4 UTSW 11 69908582 missense probably damaging 1.00
R7804:Neurl4 UTSW 11 69905874 missense probably benign 0.00
R7871:Neurl4 UTSW 11 69903186 missense probably benign
R8092:Neurl4 UTSW 11 69911065 missense probably benign
R8121:Neurl4 UTSW 11 69908230 splice site probably null
R8131:Neurl4 UTSW 11 69909241 missense probably benign 0.12
R8289:Neurl4 UTSW 11 69909380 critical splice donor site probably null
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Z1177:Neurl4 UTSW 11 69904090 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- CCCAGGTCTCTTCACAGGTAC -3'
(R):5'- TTTGAAAGACTTGGTATCCATACAC -3'

Sequencing Primer
(F):5'- GGTACTACCTCCATCCTGAGCTG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2019-09-13