Incidental Mutation 'R7361:Klhl24'
ID571379
Institutional Source Beutler Lab
Gene Symbol Klhl24
Ensembl Gene ENSMUSG00000062901
Gene Namekelch-like 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20097542-20129221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 20118000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 453 (I453L)
Ref Sequence ENSEMBL: ENSMUSP00000023509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023509]
Predicted Effect probably benign
Transcript: ENSMUST00000023509
AA Change: I453L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023509
Gene: ENSMUSG00000062901
AA Change: I453L

DomainStartEndE-ValueType
BTB 66 163 3.49e-29 SMART
BACK 168 270 1.53e-38 SMART
Kelch 314 363 8.21e-2 SMART
Kelch 364 407 6.04e-3 SMART
Kelch 408 454 5.71e-13 SMART
Kelch 455 502 1.51e-3 SMART
Kelch 503 544 9.19e-1 SMART
Kelch 545 592 2.43e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin ligase substrate receptor and is regulated by autoubiquitination. Variations in the translation initiation codon of this gene have been found, which result in an N-terminally truncated but more stable protein due to loss of the autoubiquitination function. The more stable mutant protein causes an increased ubiquitin and degradation of keratin 14, which leads to skin fragility and the potentially life-threatening disease epidermolysis bullosa. The encoded protein is also involved in the regulation of kainate receptors. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il12rb2 G T 6: 67,303,466 L586I possibly damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Klhl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Klhl24 APN 16 20122967 missense possibly damaging 0.78
IGL02419:Klhl24 APN 16 20107368 nonsense probably null
IGL02504:Klhl24 APN 16 20115943 nonsense probably null
IGL02799:Klhl24 UTSW 16 20114581 missense probably damaging 1.00
PIT4585001:Klhl24 UTSW 16 20106888 missense probably benign
R1512:Klhl24 UTSW 16 20122936 missense probably damaging 1.00
R1658:Klhl24 UTSW 16 20107092 nonsense probably null
R2076:Klhl24 UTSW 16 20117878 missense probably damaging 0.98
R2504:Klhl24 UTSW 16 20120167 missense probably benign 0.00
R4084:Klhl24 UTSW 16 20114562 missense probably damaging 0.98
R4299:Klhl24 UTSW 16 20107004 missense probably damaging 1.00
R4624:Klhl24 UTSW 16 20120123 missense probably damaging 1.00
R4780:Klhl24 UTSW 16 20106958 missense probably damaging 0.99
R5652:Klhl24 UTSW 16 20120247 nonsense probably null
R5827:Klhl24 UTSW 16 20120121 nonsense probably null
R6363:Klhl24 UTSW 16 20120183 missense possibly damaging 0.52
R6734:Klhl24 UTSW 16 20107529 missense probably damaging 1.00
R7069:Klhl24 UTSW 16 20107481 missense probably benign 0.06
R7482:Klhl24 UTSW 16 20114655 missense possibly damaging 0.48
R7894:Klhl24 UTSW 16 20123000 missense probably damaging 1.00
R8229:Klhl24 UTSW 16 20114571 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGTTATAGCCGTCAAGTCCTTG -3'
(R):5'- AATGCCTTTCCCCTCAAAGAAG -3'

Sequencing Primer
(F):5'- CAAGTCCTTGAATGAGAGAGATTCTC -3'
(R):5'- TTTCCCCTCAAAGAAGAAAATACCAG -3'
Posted On2019-09-13