Incidental Mutation 'R0646:Zbtb49'
ID 57139
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission 038831-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R0646 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 38347076-38377798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 38358018 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 745 (M745R)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
AlphaFold Q8BXX2
Predicted Effect probably damaging
Transcript: ENSMUST00000094833
AA Change: M745R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: M745R

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124939
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146859
SMART Domains Protein: ENSMUSP00000114955
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
ZnF_C2H2 11 33 1.26e-2 SMART
ZnF_C2H2 39 61 5.14e-3 SMART
Meta Mutation Damage Score 0.3154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik C T 7: 29,260,710 (GRCm39) noncoding transcript Het
Abcb11 A G 2: 69,115,627 (GRCm39) I579T probably damaging Het
Abcc9 T C 6: 142,627,830 (GRCm39) N400S probably benign Het
Adarb2 T C 13: 8,781,855 (GRCm39) L577P probably damaging Het
Agt A C 8: 125,283,852 (GRCm39) N422K probably damaging Het
Ahnak A T 19: 8,990,766 (GRCm39) K4017* probably null Het
Akap13 C A 7: 75,397,494 (GRCm39) Q2575K probably damaging Het
Aldh3a2 A T 11: 61,144,541 (GRCm39) I339K probably damaging Het
Alox15 G T 11: 70,236,450 (GRCm39) Y483* probably null Het
Ampd1 A T 3: 103,006,913 (GRCm39) I713F probably damaging Het
Amph A T 13: 19,297,286 (GRCm39) E344V possibly damaging Het
Arhgef18 T C 8: 3,436,959 (GRCm39) Y250H probably damaging Het
Arid5b A G 10: 67,932,807 (GRCm39) S1032P probably damaging Het
Armc8 C A 9: 99,387,741 (GRCm39) L393F probably damaging Het
Bpnt1 A G 1: 185,077,623 (GRCm39) probably null Het
Cachd1 G A 4: 100,845,418 (GRCm39) R970H probably damaging Het
Cd207 T C 6: 83,652,738 (GRCm39) T131A probably benign Het
Cd83 G A 13: 43,951,009 (GRCm39) V54I probably benign Het
Cfap43 T C 19: 47,752,115 (GRCm39) K1086E probably benign Het
Cfap65 A T 1: 74,941,328 (GRCm39) V1837E probably benign Het
Clcnka T A 4: 141,123,917 (GRCm39) H89L probably benign Het
Cnga4 T C 7: 105,054,182 (GRCm39) I50T possibly damaging Het
Cog5 A G 12: 31,887,358 (GRCm39) probably benign Het
Col11a2 T A 17: 34,278,322 (GRCm39) probably null Het
Col28a1 T G 6: 8,175,291 (GRCm39) I186L possibly damaging Het
Col4a2 T A 8: 11,481,252 (GRCm39) M808K probably benign Het
Copb2 A G 9: 98,445,528 (GRCm39) probably benign Het
Dbnl G A 11: 5,745,441 (GRCm39) probably benign Het
Dbx2 T C 15: 95,552,493 (GRCm39) T51A possibly damaging Het
Dcp1a A T 14: 30,224,842 (GRCm39) M123L probably damaging Het
Ddx42 T A 11: 106,123,659 (GRCm39) F217I probably benign Het
Dlc1 T C 8: 37,325,205 (GRCm39) T367A probably benign Het
Dmgdh A T 13: 93,888,863 (GRCm39) T834S probably benign Het
Dnah8 T C 17: 30,903,147 (GRCm39) S929P probably damaging Het
Dnase1l2 C A 17: 24,660,056 (GRCm39) V271L possibly damaging Het
Dsc1 T C 18: 20,229,114 (GRCm39) Y392C probably damaging Het
Edn1 T C 13: 42,458,718 (GRCm39) probably benign Het
Efcab3 G A 11: 104,611,327 (GRCm39) D390N probably benign Het
Eps8l3 T C 3: 107,792,126 (GRCm39) L351P probably damaging Het
F12 G A 13: 55,570,296 (GRCm39) probably benign Het
Fam47e T C 5: 92,726,317 (GRCm39) probably benign Het
Fcrl5 C A 3: 87,349,320 (GRCm39) Q32K probably benign Het
Fndc1 C T 17: 7,960,505 (GRCm39) V1637I possibly damaging Het
Foxg1 G T 12: 49,431,350 (GRCm39) probably benign Het
Frrs1 A T 3: 116,696,070 (GRCm39) I530F possibly damaging Het
Galnt5 A T 2: 57,889,097 (GRCm39) K232N probably benign Het
Ggt5 G A 10: 75,438,482 (GRCm39) V68M probably damaging Het
Gm16519 T C 17: 71,236,101 (GRCm39) C17R probably benign Het
Gm17535 A G 9: 3,035,804 (GRCm39) Y224C probably null Het
Gm9631 T G 11: 121,836,455 (GRCm39) D28A probably damaging Het
Gpx2 T C 12: 76,842,087 (GRCm39) I21M probably benign Het
H2-Q2 T G 17: 35,564,661 (GRCm39) D354E probably damaging Het
Icam2 A T 11: 106,271,717 (GRCm39) I71K probably damaging Het
Il12a T C 3: 68,605,223 (GRCm39) probably benign Het
Insm2 C G 12: 55,647,225 (GRCm39) A323G probably benign Het
Itga1 T C 13: 115,104,835 (GRCm39) T1064A probably benign Het
Itgad T A 7: 127,773,176 (GRCm39) V11E possibly damaging Het
Kctd15 C T 7: 34,344,306 (GRCm39) S115N probably damaging Het
Klra5 A G 6: 129,880,527 (GRCm39) W124R probably damaging Het
Kng2 T A 16: 22,806,486 (GRCm39) D571V probably benign Het
Kpna6 A T 4: 129,544,583 (GRCm39) F380I probably benign Het
Lipo3 A T 19: 33,762,169 (GRCm39) Y109* probably null Het
Lrrc37 T A 11: 103,503,986 (GRCm39) K485* probably null Het
Man2a2 T C 7: 80,012,945 (GRCm39) H540R possibly damaging Het
Map2k4 T C 11: 65,603,101 (GRCm39) E188G probably damaging Het
Mast4 T C 13: 102,895,252 (GRCm39) probably benign Het
Mbtd1 A G 11: 93,796,038 (GRCm39) D25G probably damaging Het
Med13 T A 11: 86,221,915 (GRCm39) Q238L possibly damaging Het
Mmachc A G 4: 116,560,851 (GRCm39) Y215H probably damaging Het
Mtor T A 4: 148,568,811 (GRCm39) Y1110* probably null Het
Nek2 A G 1: 191,554,331 (GRCm39) N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,443,431 (GRCm39) probably null Het
Neo1 G T 9: 58,838,317 (GRCm39) T489K probably damaging Het
Neu1 T A 17: 35,153,736 (GRCm39) Y387N probably damaging Het
Nfasc A T 1: 132,536,176 (GRCm39) C586* probably null Het
Nle1 G A 11: 82,795,671 (GRCm39) L259F probably damaging Het
Nrde2 G A 12: 100,110,105 (GRCm39) Q309* probably null Het
Nufip2 C T 11: 77,577,279 (GRCm39) H76Y probably benign Het
Or10ak16 A C 4: 118,750,687 (GRCm39) T136P probably damaging Het
Or2y13 A T 11: 49,415,405 (GRCm39) N285I probably damaging Het
Or4k6 A T 14: 50,476,096 (GRCm39) I82N probably damaging Het
Or52e18 A T 7: 104,609,018 (GRCm39) I307N probably benign Het
Or52r1c T C 7: 102,735,358 (GRCm39) F206S probably damaging Het
Or9s18 A T 13: 65,300,877 (GRCm39) I280F probably damaging Het
Pcdhb5 A G 18: 37,454,675 (GRCm39) T352A probably benign Het
Pcdhb7 A T 18: 37,476,442 (GRCm39) D526V probably damaging Het
Phkg1 A T 5: 129,893,394 (GRCm39) probably null Het
Plg C T 17: 12,637,623 (GRCm39) T744M probably damaging Het
Plxnd1 A C 6: 115,935,660 (GRCm39) probably benign Het
Poglut1 A T 16: 38,349,837 (GRCm39) I312N probably damaging Het
Ppp1r16a C T 15: 76,574,999 (GRCm39) probably benign Het
Ppt1 A G 4: 122,737,892 (GRCm39) M77V probably benign Het
Pramel26 A C 4: 143,539,155 (GRCm39) S113A possibly damaging Het
Pramel5 G T 4: 143,998,190 (GRCm39) T351N probably damaging Het
Psmb4 G A 3: 94,792,275 (GRCm39) R216C probably benign Het
Ptprd T C 4: 76,002,640 (GRCm39) T699A probably damaging Het
Retreg3 A T 11: 100,989,455 (GRCm39) probably benign Het
Sanbr C T 11: 23,525,491 (GRCm39) R716H probably damaging Het
Scaper G A 9: 55,665,340 (GRCm39) A389V probably damaging Het
Serinc5 G A 13: 92,825,245 (GRCm39) D225N possibly damaging Het
Slco1a1 T G 6: 141,871,480 (GRCm39) probably benign Het
Snapc1 C T 12: 74,021,806 (GRCm39) R81C probably damaging Het
Sod3 A T 5: 52,525,421 (GRCm39) D40V probably benign Het
Sorcs3 C A 19: 48,194,734 (GRCm39) A39E probably benign Het
Spon1 A T 7: 113,639,056 (GRCm39) T761S probably benign Het
Syde2 A G 3: 145,720,004 (GRCm39) probably null Het
Synm T A 7: 67,408,916 (GRCm39) D154V probably benign Het
Synpo2 T C 3: 122,908,098 (GRCm39) E406G probably damaging Het
Tcea3 T A 4: 135,975,382 (GRCm39) L8* probably null Het
Tec G A 5: 72,980,840 (GRCm39) L33F probably damaging Het
Tex15 T A 8: 34,072,354 (GRCm39) S2634T possibly damaging Het
Tg T A 15: 66,601,475 (GRCm39) Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 (GRCm39) V853I probably benign Het
Togaram1 A G 12: 65,068,240 (GRCm39) K1748E probably damaging Het
Ttn T C 2: 76,728,822 (GRCm39) probably benign Het
Usp36 C T 11: 118,163,847 (GRCm39) D234N probably damaging Het
Usp40 G A 1: 87,906,244 (GRCm39) P664S probably benign Het
Vmn1r54 T A 6: 90,246,635 (GRCm39) L183H probably benign Het
Vmn1r58 T G 7: 5,413,676 (GRCm39) I185L probably benign Het
Wnt8a A T 18: 34,680,618 (GRCm39) R328W probably benign Het
Yars1 A G 4: 129,107,732 (GRCm39) probably benign Het
Zeb1 T G 18: 5,759,027 (GRCm39) F162V probably damaging Het
Zfp369 A T 13: 65,445,362 (GRCm39) H835L probably damaging Het
Zic5 A G 14: 122,701,351 (GRCm39) V460A unknown Het
Zp3 A G 5: 136,013,210 (GRCm39) N181D possibly damaging Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38,367,960 (GRCm39) critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38,358,204 (GRCm39) missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38,373,820 (GRCm39) missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38,358,174 (GRCm39) missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38,371,263 (GRCm39) missense probably benign 0.08
R1200:Zbtb49 UTSW 5 38,370,675 (GRCm39) missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38,371,038 (GRCm39) missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38,361,105 (GRCm39) nonsense probably null
R2155:Zbtb49 UTSW 5 38,371,464 (GRCm39) missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38,360,701 (GRCm39) intron probably benign
R3617:Zbtb49 UTSW 5 38,357,975 (GRCm39) unclassified probably benign
R4937:Zbtb49 UTSW 5 38,371,307 (GRCm39) missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38,358,160 (GRCm39) missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38,373,870 (GRCm39) missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38,360,903 (GRCm39) missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38,360,431 (GRCm39) splice site probably null
R6735:Zbtb49 UTSW 5 38,358,402 (GRCm39) missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38,370,585 (GRCm39) intron probably benign
R6869:Zbtb49 UTSW 5 38,371,694 (GRCm39) missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38,370,711 (GRCm39) nonsense probably null
R7899:Zbtb49 UTSW 5 38,371,274 (GRCm39) nonsense probably null
R8041:Zbtb49 UTSW 5 38,358,198 (GRCm39) missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38,358,453 (GRCm39) missense probably benign 0.04
R8517:Zbtb49 UTSW 5 38,357,997 (GRCm39) missense probably benign 0.25
R8523:Zbtb49 UTSW 5 38,370,669 (GRCm39) missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38,358,289 (GRCm39) missense probably benign
R9160:Zbtb49 UTSW 5 38,363,246 (GRCm39) missense probably damaging 0.99
R9301:Zbtb49 UTSW 5 38,370,931 (GRCm39) missense probably benign
R9315:Zbtb49 UTSW 5 38,358,082 (GRCm39) missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38,358,409 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCGCTGTTGCACTGATGTGAATC -3'
(R):5'- CTGAGCCTGGAACCTTCTAAGCTG -3'

Sequencing Primer
(F):5'- AGCTGTCCTCACCCTAGACTG -3'
(R):5'- TACTCAGATGTGGAGCCCTCAG -3'
Posted On 2013-07-11