Mutagenetix > Incidental Mutations

Incidental Mutation 'R7362:Bfsp1'

571397

Institutional Source

Beutler Lab

Gene Symbol

Bfsp1

Ensembl Gene

ENSMUSG00000027420

Gene Name

beaded filament structural protein 1, in lens-CP94

Synonyms

filensin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.190) question?

Stock #

R7362 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

143826528-143863173 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 143826875 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 601 (P601A)

Ref Sequence

ENSEMBL: ENSMUSP00000096899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028907] [ENSMUST00000099296]

Predicted Effect

probably benign
Transcript: ENSMUST00000028907
AA Change: P595A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028907
Gene: ENSMUSG00000027420
AA Change: P595A

Domain	Start	End	E-Value	Type
Pfam:Filament	34	205	2.5e-13	PFAM
low complexity region	400	411	N/A	INTRINSIC
low complexity region	544	561	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099296
AA Change: P601A

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000096899
Gene: ENSMUSG00000027420
AA Change: P601A

Domain	Start	End	E-Value	Type
Filament	32	317	1.05e-6	SMART
low complexity region	406	417	N/A	INTRINSIC
low complexity region	550	567	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lens-specific intermediate filament-like protein named filensin. The encoded protein is expressed in lens fiber cells after differentiation has begun. This protein functions as a component of the beaded filament which is a cytoskeletal structure found in lens fiber cells. Mutations in this gene are the cause of autosomal recessive cortical juvenile-onset cataract. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mutations in this gene produce lens abnormalities progressing to cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	A	10: 82,292,997	Q1393L	possibly damaging	Het
Adprhl1	C	T	8: 13,245,534	R193K	probably damaging	Het
Aoc1	G	T	6: 48,905,411	V74L	probably benign	Het
Bicd1	A	C	6: 149,484,093	K108T	probably benign	Het
Btbd18	C	T	2: 84,661,543	Q23*	probably null	Het
Ccser1	A	G	6: 61,810,880	I227M	unknown	Het
Cd151	G	A	7: 141,469,589	V70I	probably benign	Het
Cdh10	A	G	15: 18,899,694	T36A	probably benign	Het
Crb2	A	G	2: 37,790,199	T380A	probably benign	Het
Csmd3	A	C	15: 47,755,992	S1829A	possibly damaging	Het
Dgat2	A	T	7: 99,154,636	H359Q	probably damaging	Het
Dhdds	T	C	4: 133,971,130	T298A	probably benign	Het
Egfem1	A	G	3: 29,151,920	Q102R	probably benign	Het
Eps15	T	A	4: 109,366,242		probably null	Het
Ern1	T	A	11: 106,437,123	D61V	probably damaging	Het
Fcamr	G	A	1: 130,814,023	R511Q	possibly damaging	Het
Grhpr	T	C	4: 44,987,255	V213A	probably benign	Het
Gsx2	A	G	5: 75,076,104	D115G	possibly damaging	Het
Hoxd3	A	G	2: 74,744,219	I70V	possibly damaging	Het
Inpp5a	A	G	7: 139,578,380	I408V	probably benign	Het
Kansl3	A	T	1: 36,344,127	D759E	possibly damaging	Het
Lrrc37a	T	G	11: 103,457,509	T2787P	unknown	Het
Mier3	G	A	13: 111,705,249	G115S	possibly damaging	Het
Mkln1	T	C	6: 31,468,168	I333T	probably benign	Het
Myt1	T	A	2: 181,797,240	V227D	probably benign	Het
Olfr403	T	C	11: 74,195,586	F28L	probably benign	Het
Olfr593	T	A	7: 103,212,654	Y265N	probably damaging	Het
Olfr863-ps1	C	T	9: 19,942,231	D70N	probably damaging	Het
Pcf11	A	G	7: 92,653,245	L1219P	possibly damaging	Het
Pde6g	T	C	11: 120,448,124	E80G	probably damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Ppp3cb	T	A	14: 20,523,651	Q304L	probably benign	Het
Prr19	T	C	7: 25,303,918	L319P	probably damaging	Het
Prss23	C	T	7: 89,509,764	A366T	probably damaging	Het
Rock2	T	C	12: 16,958,421	L560P	probably damaging	Het
Simc1	A	T	13: 54,539,704	R95S	probably damaging	Het
Slc10a6	A	T	5: 103,629,126	V36E	probably damaging	Het
Slco1c1	A	T	6: 141,569,463	T695S	probably benign	Het
Ssh2	T	C	11: 77,449,650	F543L	probably benign	Het
Tecpr2	T	A	12: 110,941,476	V999D	possibly damaging	Het
Tnfsf10	A	T	3: 27,335,348	Y186F	probably damaging	Het
Tnk2	A	T	16: 32,675,520		probably null	Het
Tram1	T	C	1: 13,589,608	M39V	probably benign	Het
Uck2	C	T	1: 167,237,642	V36I	possibly damaging	Het
Ugcg	T	A	4: 59,217,109	M211K	probably damaging	Het
Vash2	A	T	1: 190,960,299	S226R	probably damaging	Het
Vmn1r172	T	A	7: 23,660,416	M242K	probably damaging	Het
Vmn2r82	A	T	10: 79,396,617	M817L	probably benign	Het
Vwa5b1	T	C	4: 138,594,312	N390S	probably damaging	Het
Wdr73	T	A	7: 80,900,703	D17V	probably damaging	Het
Wdr91	A	T	6: 34,889,115	S501T	possibly damaging	Het
Zfp454	A	G	11: 50,886,367		probably null	Het

Other mutations in Bfsp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Bfsp1	APN	2	143831892	missense	probably damaging	1.00
IGL01457:Bfsp1	APN	2	143827644	splice site	probably benign
IGL02329:Bfsp1	APN	2	143862646	missense	probably benign
IGL02354:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02361:Bfsp1	APN	2	143831987	missense	probably damaging	1.00
IGL02365:Bfsp1	APN	2	143826736	missense	probably damaging	1.00
IGL02407:Bfsp1	APN	2	143826933	missense	probably benign	0.00
IGL03118:Bfsp1	APN	2	143827333	missense	possibly damaging	0.94
I0000:Bfsp1	UTSW	2	143845968	missense	probably damaging	1.00
R0112:Bfsp1	UTSW	2	143827643	splice site	probably null
R0657:Bfsp1	UTSW	2	143827650	splice site	probably benign
R1642:Bfsp1	UTSW	2	143841763	missense	probably damaging	1.00
R1816:Bfsp1	UTSW	2	143841679	missense	probably benign	0.23
R2061:Bfsp1	UTSW	2	143862678	missense	probably benign	0.08
R2248:Bfsp1	UTSW	2	143827652	splice site	probably null
R3024:Bfsp1	UTSW	2	143845959	missense	probably benign	0.19
R4029:Bfsp1	UTSW	2	143831829	splice site	probably benign
R4914:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4915:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4917:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R4918:Bfsp1	UTSW	2	143827471	missense	probably benign	0.21
R5018:Bfsp1	UTSW	2	143862882	missense	possibly damaging	0.81
R5202:Bfsp1	UTSW	2	143826971	missense	probably benign
R5267:Bfsp1	UTSW	2	143827051	missense	probably benign	0.03
R5304:Bfsp1	UTSW	2	143827291	missense	probably benign	0.34
R5825:Bfsp1	UTSW	2	143827459	missense	probably benign	0.01
R6465:Bfsp1	UTSW	2	143858055	critical splice donor site	probably null
R6888:Bfsp1	UTSW	2	143826719	missense	probably benign	0.31
R7036:Bfsp1	UTSW	2	143826923	missense	possibly damaging	0.65
R7075:Bfsp1	UTSW	2	143848965	missense	probably damaging	1.00
R7538:Bfsp1	UTSW	2	143831835	critical splice donor site	probably null
R7839:Bfsp1	UTSW	2	143831850	missense	possibly damaging	0.79
X0022:Bfsp1	UTSW	2	143858117	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTCAAGCCCTTGTGTCTGG -3'
(R):5'- ACCATCAGCAGGGTACAGAC -3'

Sequencing Primer
(F):5'- CCCTTGTGTCTGGCAAGC -3'
(R):5'- CAAGAATGGGTTACGGGCC -3'

Posted On

2019-09-13