Incidental Mutation 'R7362:Egfem1'
ID571400
Institutional Source Beutler Lab
Gene Symbol Egfem1
Ensembl Gene ENSMUSG00000063600
Gene NameEGF-like and EMI domain containing 1
Synonyms6130401L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7362 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location29082023-29691209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29151920 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 102 (Q102R)
Ref Sequence ENSEMBL: ENSMUSP00000112943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118531] [ENSMUST00000119598] [ENSMUST00000124809] [ENSMUST00000146943]
Predicted Effect probably benign
Transcript: ENSMUST00000118531
AA Change: Q102R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112907
Gene: ENSMUSG00000063600
AA Change: Q102R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 30 104 1.4e-15 PFAM
Blast:EGF_like 108 145 7e-10 BLAST
EGF 150 187 2.16e1 SMART
EGF_CA 188 228 2.66e-10 SMART
EGF 237 274 1.08e-1 SMART
EGF_like 275 313 9.19e-5 SMART
low complexity region 317 331 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
EGF 391 424 1.09e1 SMART
Blast:EGF_like 449 481 5e-10 BLAST
EGF 492 526 2.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119598
AA Change: Q102R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112943
Gene: ENSMUSG00000063600
AA Change: Q102R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EMI 31 102 1.1e-15 PFAM
Blast:EGF_like 108 145 6e-10 BLAST
EGF_CA 164 204 1.61e-9 SMART
EGF 208 244 6.4e-4 SMART
EGF_CA 245 285 1.81e-12 SMART
EGF 294 331 1.08e-1 SMART
EGF_like 332 370 9.19e-5 SMART
low complexity region 374 388 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
EGF 448 481 1.09e1 SMART
Blast:EGF_like 506 538 5e-10 BLAST
EGF 549 583 2.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124809
AA Change: Q81R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114314
Gene: ENSMUSG00000063600
AA Change: Q81R

DomainStartEndE-ValueType
Pfam:EMI 9 83 7.7e-17 PFAM
Blast:EGF_like 87 124 6e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000146943
AA Change: Q89R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118156
Gene: ENSMUSG00000063600
AA Change: Q89R

DomainStartEndE-ValueType
Pfam:EMI 17 91 1.8e-16 PFAM
Blast:EGF_like 95 132 2e-11 BLAST
EGF 137 174 2.16e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,292,997 Q1393L possibly damaging Het
Adprhl1 C T 8: 13,245,534 R193K probably damaging Het
Aoc1 G T 6: 48,905,411 V74L probably benign Het
Bfsp1 G C 2: 143,826,875 P601A probably benign Het
Bicd1 A C 6: 149,484,093 K108T probably benign Het
Btbd18 C T 2: 84,661,543 Q23* probably null Het
Ccser1 A G 6: 61,810,880 I227M unknown Het
Cd151 G A 7: 141,469,589 V70I probably benign Het
Cdh10 A G 15: 18,899,694 T36A probably benign Het
Crb2 A G 2: 37,790,199 T380A probably benign Het
Csmd3 A C 15: 47,755,992 S1829A possibly damaging Het
Dgat2 A T 7: 99,154,636 H359Q probably damaging Het
Dhdds T C 4: 133,971,130 T298A probably benign Het
Eps15 T A 4: 109,366,242 probably null Het
Ern1 T A 11: 106,437,123 D61V probably damaging Het
Fcamr G A 1: 130,814,023 R511Q possibly damaging Het
Grhpr T C 4: 44,987,255 V213A probably benign Het
Gsx2 A G 5: 75,076,104 D115G possibly damaging Het
Hoxd3 A G 2: 74,744,219 I70V possibly damaging Het
Inpp5a A G 7: 139,578,380 I408V probably benign Het
Kansl3 A T 1: 36,344,127 D759E possibly damaging Het
Lrrc37a T G 11: 103,457,509 T2787P unknown Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mkln1 T C 6: 31,468,168 I333T probably benign Het
Myt1 T A 2: 181,797,240 V227D probably benign Het
Olfr403 T C 11: 74,195,586 F28L probably benign Het
Olfr593 T A 7: 103,212,654 Y265N probably damaging Het
Olfr863-ps1 C T 9: 19,942,231 D70N probably damaging Het
Pcf11 A G 7: 92,653,245 L1219P possibly damaging Het
Pde6g T C 11: 120,448,124 E80G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp3cb T A 14: 20,523,651 Q304L probably benign Het
Prr19 T C 7: 25,303,918 L319P probably damaging Het
Prss23 C T 7: 89,509,764 A366T probably damaging Het
Rock2 T C 12: 16,958,421 L560P probably damaging Het
Simc1 A T 13: 54,539,704 R95S probably damaging Het
Slc10a6 A T 5: 103,629,126 V36E probably damaging Het
Slco1c1 A T 6: 141,569,463 T695S probably benign Het
Ssh2 T C 11: 77,449,650 F543L probably benign Het
Tecpr2 T A 12: 110,941,476 V999D possibly damaging Het
Tnfsf10 A T 3: 27,335,348 Y186F probably damaging Het
Tnk2 A T 16: 32,675,520 probably null Het
Tram1 T C 1: 13,589,608 M39V probably benign Het
Uck2 C T 1: 167,237,642 V36I possibly damaging Het
Ugcg T A 4: 59,217,109 M211K probably damaging Het
Vash2 A T 1: 190,960,299 S226R probably damaging Het
Vmn1r172 T A 7: 23,660,416 M242K probably damaging Het
Vmn2r82 A T 10: 79,396,617 M817L probably benign Het
Vwa5b1 T C 4: 138,594,312 N390S probably damaging Het
Wdr73 T A 7: 80,900,703 D17V probably damaging Het
Wdr91 A T 6: 34,889,115 S501T possibly damaging Het
Zfp454 A G 11: 50,886,367 probably null Het
Other mutations in Egfem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Egfem1 APN 3 29657153 missense possibly damaging 0.54
IGL02111:Egfem1 APN 3 29650896 splice site probably null
IGL02325:Egfem1 APN 3 29151917 missense probably benign 0.01
IGL02450:Egfem1 APN 3 29657268 critical splice donor site probably null
IGL02543:Egfem1 APN 3 29668380 missense probably benign 0.01
IGL02835:Egfem1 UTSW 3 29657241 missense probably damaging 1.00
P0033:Egfem1 UTSW 3 29690191 missense probably damaging 1.00
R0010:Egfem1 UTSW 3 29582919 missense probably damaging 1.00
R0294:Egfem1 UTSW 3 29690121 missense probably damaging 1.00
R0379:Egfem1 UTSW 3 29668250 missense possibly damaging 0.92
R1479:Egfem1 UTSW 3 29657165 missense probably damaging 1.00
R1572:Egfem1 UTSW 3 29648271 missense probably benign 0.02
R1754:Egfem1 UTSW 3 29668333 missense possibly damaging 0.68
R2568:Egfem1 UTSW 3 29582931 missense probably damaging 1.00
R2679:Egfem1 UTSW 3 29670676 missense probably benign 0.01
R3411:Egfem1 UTSW 3 29583021 missense probably damaging 1.00
R3801:Egfem1 UTSW 3 29151926 missense probably benign 0.14
R4049:Egfem1 UTSW 3 29686731 missense probably benign 0.01
R4851:Egfem1 UTSW 3 29151883 missense possibly damaging 0.92
R4917:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4918:Egfem1 UTSW 3 29151893 missense probably damaging 1.00
R4969:Egfem1 UTSW 3 29582996 missense probably damaging 0.98
R4997:Egfem1 UTSW 3 29153590 missense probably benign 0.00
R5148:Egfem1 UTSW 3 29457823 intron probably benign
R5194:Egfem1 UTSW 3 29357196 critical splice donor site probably null
R5284:Egfem1 UTSW 3 29650787 missense possibly damaging 0.53
R5354:Egfem1 UTSW 3 29082212 critical splice donor site probably null
R5627:Egfem1 UTSW 3 29668399 nonsense probably null
R5677:Egfem1 UTSW 3 29690174 missense probably damaging 0.99
R5928:Egfem1 UTSW 3 29582928 missense possibly damaging 0.92
R5982:Egfem1 UTSW 3 29657270 splice site probably null
R6419:Egfem1 UTSW 3 29657249 missense probably damaging 1.00
R6475:Egfem1 UTSW 3 29657163 missense probably damaging 1.00
R6586:Egfem1 UTSW 3 29662411 nonsense probably null
R7046:Egfem1 UTSW 3 29082215 splice site probably null
R7079:Egfem1 UTSW 3 29153582 missense probably benign 0.00
R7308:Egfem1 UTSW 3 29151866 missense probably benign 0.09
R7684:Egfem1 UTSW 3 29690185 missense probably damaging 0.97
R7697:Egfem1 UTSW 3 29690197 critical splice donor site probably null
R7814:Egfem1 UTSW 3 29686791 missense probably damaging 1.00
R8226:Egfem1 UTSW 3 29657255 missense probably damaging 1.00
R8429:Egfem1 UTSW 3 29657268 critical splice donor site probably null
X0028:Egfem1 UTSW 3 29657146 missense probably damaging 1.00
Z1177:Egfem1 UTSW 3 29148453 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCCCAATGTATGTGGCAGGG -3'
(R):5'- TGAGCTGCAACCCACCATTAAG -3'

Sequencing Primer
(F):5'- AATGTATGTGGCAGGGTTTGAATTAG -3'
(R):5'- AGAGCAGTGTTTCTCAACCTG -3'
Posted On2019-09-13