Incidental Mutation 'R7362:Olfr863-ps1'
ID571425
Institutional Source Beutler Lab
Gene Symbol Olfr863-ps1
Ensembl Gene
Gene Nameolfactory receptor 863, pseudogene 1
SynonymsGA_x6K02T2PVTD-13682249-13681321, MOR146-11_p, MOR146-5P
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7362 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location19941471-19942438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19942231 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 70 (D70N)
Ref Sequence ENSEMBL: ENSMUSP00000148567 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000213073
AA Change: D70N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,292,997 Q1393L possibly damaging Het
Adprhl1 C T 8: 13,245,534 R193K probably damaging Het
Aoc1 G T 6: 48,905,411 V74L probably benign Het
Bfsp1 G C 2: 143,826,875 P601A probably benign Het
Bicd1 A C 6: 149,484,093 K108T probably benign Het
Btbd18 C T 2: 84,661,543 Q23* probably null Het
Ccser1 A G 6: 61,810,880 I227M unknown Het
Cd151 G A 7: 141,469,589 V70I probably benign Het
Cdh10 A G 15: 18,899,694 T36A probably benign Het
Crb2 A G 2: 37,790,199 T380A probably benign Het
Csmd3 A C 15: 47,755,992 S1829A possibly damaging Het
Dgat2 A T 7: 99,154,636 H359Q probably damaging Het
Dhdds T C 4: 133,971,130 T298A probably benign Het
Egfem1 A G 3: 29,151,920 Q102R probably benign Het
Eps15 T A 4: 109,366,242 probably null Het
Ern1 T A 11: 106,437,123 D61V probably damaging Het
Fcamr G A 1: 130,814,023 R511Q possibly damaging Het
Grhpr T C 4: 44,987,255 V213A probably benign Het
Gsx2 A G 5: 75,076,104 D115G possibly damaging Het
Hoxd3 A G 2: 74,744,219 I70V possibly damaging Het
Inpp5a A G 7: 139,578,380 I408V probably benign Het
Kansl3 A T 1: 36,344,127 D759E possibly damaging Het
Lrrc37a T G 11: 103,457,509 T2787P unknown Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mkln1 T C 6: 31,468,168 I333T probably benign Het
Myt1 T A 2: 181,797,240 V227D probably benign Het
Olfr403 T C 11: 74,195,586 F28L probably benign Het
Olfr593 T A 7: 103,212,654 Y265N probably damaging Het
Pcf11 A G 7: 92,653,245 L1219P possibly damaging Het
Pde6g T C 11: 120,448,124 E80G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp3cb T A 14: 20,523,651 Q304L probably benign Het
Prr19 T C 7: 25,303,918 L319P probably damaging Het
Prss23 C T 7: 89,509,764 A366T probably damaging Het
Rock2 T C 12: 16,958,421 L560P probably damaging Het
Simc1 A T 13: 54,539,704 R95S probably damaging Het
Slc10a6 A T 5: 103,629,126 V36E probably damaging Het
Slco1c1 A T 6: 141,569,463 T695S probably benign Het
Ssh2 T C 11: 77,449,650 F543L probably benign Het
Tecpr2 T A 12: 110,941,476 V999D possibly damaging Het
Tnfsf10 A T 3: 27,335,348 Y186F probably damaging Het
Tnk2 A T 16: 32,675,520 probably null Het
Tram1 T C 1: 13,589,608 M39V probably benign Het
Uck2 C T 1: 167,237,642 V36I possibly damaging Het
Ugcg T A 4: 59,217,109 M211K probably damaging Het
Vash2 A T 1: 190,960,299 S226R probably damaging Het
Vmn1r172 T A 7: 23,660,416 M242K probably damaging Het
Vmn2r82 A T 10: 79,396,617 M817L probably benign Het
Vwa5b1 T C 4: 138,594,312 N390S probably damaging Het
Wdr73 T A 7: 80,900,703 D17V probably damaging Het
Wdr91 A T 6: 34,889,115 S501T possibly damaging Het
Zfp454 A G 11: 50,886,367 probably null Het
Other mutations in Olfr863-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6774:Olfr863-ps1 UTSW 9 19941774 missense unknown
R7231:Olfr863-ps1 UTSW 9 19941559 missense unknown
R7790:Olfr863-ps1 UTSW 9 19941684 missense unknown
R8004:Olfr863-ps1 UTSW 9 19942112 missense possibly damaging 0.68
R8021:Olfr863-ps1 UTSW 9 19942079 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCTACACAGACAAGGGTTCAG -3'
(R):5'- GAACTTTGGAATTCCTTCTCCTTGG -3'

Sequencing Primer
(F):5'- TCAGAATGACTTGGTAGTGCAG -3'
(R):5'- TTGGACTCTCAGAAGACCCTG -3'
Posted On2019-09-13