Incidental Mutation 'R7362:Tecpr2'
ID571435
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7362 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110941476 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 999 (V999D)
Ref Sequence ENSEMBL: ENSMUSP00000127949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165978
AA Change: V999D

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: V999D

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169597
AA Change: V999D

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: V999D

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,292,997 Q1393L possibly damaging Het
Adprhl1 C T 8: 13,245,534 R193K probably damaging Het
Aoc1 G T 6: 48,905,411 V74L probably benign Het
Bfsp1 G C 2: 143,826,875 P601A probably benign Het
Bicd1 A C 6: 149,484,093 K108T probably benign Het
Btbd18 C T 2: 84,661,543 Q23* probably null Het
Ccser1 A G 6: 61,810,880 I227M unknown Het
Cd151 G A 7: 141,469,589 V70I probably benign Het
Cdh10 A G 15: 18,899,694 T36A probably benign Het
Crb2 A G 2: 37,790,199 T380A probably benign Het
Csmd3 A C 15: 47,755,992 S1829A possibly damaging Het
Dgat2 A T 7: 99,154,636 H359Q probably damaging Het
Dhdds T C 4: 133,971,130 T298A probably benign Het
Egfem1 A G 3: 29,151,920 Q102R probably benign Het
Eps15 T A 4: 109,366,242 probably null Het
Ern1 T A 11: 106,437,123 D61V probably damaging Het
Fcamr G A 1: 130,814,023 R511Q possibly damaging Het
Grhpr T C 4: 44,987,255 V213A probably benign Het
Gsx2 A G 5: 75,076,104 D115G possibly damaging Het
Hoxd3 A G 2: 74,744,219 I70V possibly damaging Het
Inpp5a A G 7: 139,578,380 I408V probably benign Het
Kansl3 A T 1: 36,344,127 D759E possibly damaging Het
Lrrc37a T G 11: 103,457,509 T2787P unknown Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mkln1 T C 6: 31,468,168 I333T probably benign Het
Myt1 T A 2: 181,797,240 V227D probably benign Het
Olfr403 T C 11: 74,195,586 F28L probably benign Het
Olfr593 T A 7: 103,212,654 Y265N probably damaging Het
Olfr863-ps1 C T 9: 19,942,231 D70N probably damaging Het
Pcf11 A G 7: 92,653,245 L1219P possibly damaging Het
Pde6g T C 11: 120,448,124 E80G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp3cb T A 14: 20,523,651 Q304L probably benign Het
Prr19 T C 7: 25,303,918 L319P probably damaging Het
Prss23 C T 7: 89,509,764 A366T probably damaging Het
Rock2 T C 12: 16,958,421 L560P probably damaging Het
Simc1 A T 13: 54,539,704 R95S probably damaging Het
Slc10a6 A T 5: 103,629,126 V36E probably damaging Het
Slco1c1 A T 6: 141,569,463 T695S probably benign Het
Ssh2 T C 11: 77,449,650 F543L probably benign Het
Tnfsf10 A T 3: 27,335,348 Y186F probably damaging Het
Tnk2 A T 16: 32,675,520 probably null Het
Tram1 T C 1: 13,589,608 M39V probably benign Het
Uck2 C T 1: 167,237,642 V36I possibly damaging Het
Ugcg T A 4: 59,217,109 M211K probably damaging Het
Vash2 A T 1: 190,960,299 S226R probably damaging Het
Vmn1r172 T A 7: 23,660,416 M242K probably damaging Het
Vmn2r82 A T 10: 79,396,617 M817L probably benign Het
Vwa5b1 T C 4: 138,594,312 N390S probably damaging Het
Wdr73 T A 7: 80,900,703 D17V probably damaging Het
Wdr91 A T 6: 34,889,115 S501T possibly damaging Het
Zfp454 A G 11: 50,886,367 probably null Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6936:Tecpr2 UTSW 12 110944863 missense possibly damaging 0.83
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGCAATGCACCTTAG -3'
(R):5'- CCACAGGAAAGTCATCTCCTAAATG -3'

Sequencing Primer
(F):5'- ATGCACCTTAGGCGCAGATC -3'
(R):5'- CTCTTAAGGAAAAGAGCGAAGGC -3'
Posted On2019-09-13