Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Zp3'

57144

Institutional Source

Beutler Lab

Gene Symbol

Zp3

Ensembl Gene

ENSMUSG00000004948

Gene Name

zona pellucida glycoprotein 3

Synonyms

Zp-3

MMRRC Submission

038831-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R0646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135980099-135988624 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135984356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 181 (N181D)

Ref Sequence

ENSEMBL: ENSMUSP00000005073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005073]

AlphaFold

P10761

PDB Structure

ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005073
AA Change: N181D

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: N181D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
ZP	45	304	1.22e-68	SMART
low complexity region	320	334	N/A	INTRINSIC
transmembrane domain	387	409	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000131563
AA Change: E134G

SMART Domains

Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948
AA Change: E134G

Domain	Start	End	E-Value	Type
Pfam:Zona_pellucida	35	136	6.4e-16	PFAM

Meta Mutation Damage Score

0.1766

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Akap13	C	A	7: 75,747,746	Q2575K	probably damaging	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Dsc1	T	C	18: 20,096,057	Y392C	probably damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mast4	T	C	13: 102,758,744		probably benign	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Ptprd	T	C	4: 76,084,403	T699A	probably damaging	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Sorcs3	C	A	19: 48,206,295	A39E	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het

Other mutations in Zp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02282:Zp3	APN	5	135984351	missense	possibly damaging	0.72
IGL02563:Zp3	APN	5	135987610	critical splice donor site	probably null
IGL03185:Zp3	APN	5	135982721	missense	possibly damaging	0.94
PIT4280001:Zp3	UTSW	5	135984464	missense	possibly damaging	0.56
R1454:Zp3	UTSW	5	135984188	missense	probably damaging	1.00
R1691:Zp3	UTSW	5	135980281	missense	possibly damaging	0.86
R3415:Zp3	UTSW	5	135985660	missense	probably benign	0.07
R4599:Zp3	UTSW	5	135984235	nonsense	probably null
R4987:Zp3	UTSW	5	135987505	nonsense	probably null
R5907:Zp3	UTSW	5	135988523	missense	probably benign	0.00
R6388:Zp3	UTSW	5	135982694	missense	probably benign	0.02
R6587:Zp3	UTSW	5	135987498	missense	possibly damaging	0.68
R6629:Zp3	UTSW	5	135987336	missense	probably benign	0.00
R7438:Zp3	UTSW	5	135982705	missense	probably damaging	1.00
R8050:Zp3	UTSW	5	135982750	missense	probably damaging	1.00
R8083:Zp3	UTSW	5	135984522	missense	probably damaging	1.00
R8158:Zp3	UTSW	5	135985564	missense	probably benign	0.15
R8421:Zp3	UTSW	5	135988477	missense	probably benign	0.00
R8447:Zp3	UTSW	5	135984390	missense	probably damaging	1.00
R8529:Zp3	UTSW	5	135987265	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTGTCAAGTGTAGGCACTCAGG -3'
(R):5'- TGACTCCCTAAGAAAGCAGGCCAG -3'

Sequencing Primer
(F):5'- GGATATGATTGCACACTGCC -3'
(R):5'- CCTCACCCGTGGAAGTCC -3'

Posted On

2013-07-11