Incidental Mutation 'R7363:Vmn2r13'
ID571466
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Namevomeronasal 2, receptor 13
SynonymsGm4867
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109156068-109192107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109192043 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 22 (H22L)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
Predicted Effect probably benign
Transcript: ENSMUST00000053253
AA Change: H22L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: H22L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109156285 missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109156847 missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2680:Vmn2r13 UTSW 5 109174312 missense possibly damaging 0.66
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109173975 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
R7276:Vmn2r13 UTSW 5 109173779 missense probably damaging 1.00
R7443:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109171691 synonymous probably null
R7607:Vmn2r13 UTSW 5 109173640 missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109171752 missense probably benign 0.00
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GAACAGGACACAATGCTACAGTTTG -3'
(R):5'- GATCTTCAGAGAGCAGTAGCC -3'

Sequencing Primer
(F):5'- CAATGCTACAGTTTGTATACACAGC -3'
(R):5'- TCTTCAGAGAGCAGTAGCCATAAAAC -3'
Posted On2019-09-13