Incidental Mutation 'R7363:Cldn23'
ID571479
Institutional Source Beutler Lab
Gene Symbol Cldn23
Ensembl Gene ENSMUSG00000055976
Gene Nameclaudin 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location35824712-35826559 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 35825505 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000060128]
Predicted Effect silent
Transcript: ENSMUST00000060128
SMART Domains Protein: ENSMUSP00000049725
Gene: ENSMUSG00000055976

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 6e-19 PFAM
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210370
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is intronless and the protein encoded by this gene is 77% identical to the human homolog. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Cldn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Cldn23 APN 8 35825920 missense possibly damaging 0.81
IGL01767:Cldn23 APN 8 35825662 missense probably damaging 1.00
IGL02078:Cldn23 APN 8 35826205 missense possibly damaging 0.94
IGL03346:Cldn23 APN 8 35825440 intron probably benign
R1610:Cldn23 UTSW 8 35825930 missense probably damaging 1.00
R1753:Cldn23 UTSW 8 35825986 missense possibly damaging 0.94
R1915:Cldn23 UTSW 8 35825945 missense possibly damaging 0.69
R2121:Cldn23 UTSW 8 35826235 missense probably benign
R4342:Cldn23 UTSW 8 35825498 missense probably benign 0.00
R5167:Cldn23 UTSW 8 35826320 missense possibly damaging 0.89
R5207:Cldn23 UTSW 8 35826028 missense probably damaging 1.00
R6102:Cldn23 UTSW 8 35825551 missense probably benign 0.00
R7106:Cldn23 UTSW 8 35825915 missense probably benign
R7721:Cldn23 UTSW 8 35826263 missense possibly damaging 0.89
R8119:Cldn23 UTSW 8 35825902 missense probably damaging 0.99
Z1176:Cldn23 UTSW 8 35826277 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGTCCCTCTGGAGAGAAAAG -3'
(R):5'- TGCCATCAAGTACTACAGCGAC -3'

Sequencing Primer
(F):5'- CCCAACCTAGTATTTGGAGAGG -3'
(R):5'- GTACTACAGCGACGGACAGC -3'
Posted On2019-09-13