Incidental Mutation 'R7363:Kcnip1'
ID571488
Institutional Source Beutler Lab
Gene Symbol Kcnip1
Ensembl Gene ENSMUSG00000053519
Gene NameKv channel-interacting protein 1
Synonyms3202002F18Rik, 2900046L02Rik, KCHIP1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location33629339-33993152 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33634589 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000104964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065970] [ENSMUST00000101368] [ENSMUST00000109340]
Predicted Effect probably benign
Transcript: ENSMUST00000065970
AA Change: V177A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069063
Gene: ENSMUSG00000053519
AA Change: V177A

DomainStartEndE-ValueType
EFh 90 118 2.24e1 SMART
EFh 126 154 8.77e-7 SMART
EFh 174 202 2.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101368
AA Change: V149A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098919
Gene: ENSMUSG00000053519
AA Change: V149A

DomainStartEndE-ValueType
EFh 62 90 2.24e1 SMART
EFh 98 126 8.77e-7 SMART
EFh 146 174 2.83e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109340
AA Change: V188A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104964
Gene: ENSMUSG00000053519
AA Change: V188A

DomainStartEndE-ValueType
EFh 101 129 2.24e1 SMART
EFh 137 165 8.77e-7 SMART
EFh 185 213 2.83e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increase susceptibility to pentylenetetrazole-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Kcnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Kcnip1 APN 11 33643289 splice site probably benign
IGL00597:Kcnip1 APN 11 33643294 critical splice donor site probably null
IGL01064:Kcnip1 APN 11 33633192 missense probably damaging 1.00
IGL01125:Kcnip1 APN 11 33633202 missense probably damaging 1.00
IGL01324:Kcnip1 APN 11 33645603 start codon destroyed probably null 0.01
IGL01409:Kcnip1 APN 11 33630593 missense probably benign 0.00
IGL02622:Kcnip1 APN 11 33643290 splice site probably benign
R0149:Kcnip1 UTSW 11 33843177 missense probably benign
R0319:Kcnip1 UTSW 11 33651529 splice site probably benign
R0361:Kcnip1 UTSW 11 33843177 missense probably benign
R1314:Kcnip1 UTSW 11 33642481 missense probably damaging 1.00
R3420:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3421:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R3422:Kcnip1 UTSW 11 33645594 missense probably damaging 1.00
R4631:Kcnip1 UTSW 11 33992821 exon noncoding transcript
R4843:Kcnip1 UTSW 11 33644504 missense probably benign 0.00
R5007:Kcnip1 UTSW 11 33642495 missense probably benign 0.05
R5337:Kcnip1 UTSW 11 33642389 intron probably benign
R5596:Kcnip1 UTSW 11 33630597 missense probably damaging 1.00
R6058:Kcnip1 UTSW 11 33642478 missense probably damaging 1.00
R6210:Kcnip1 UTSW 11 33645600 missense possibly damaging 0.93
R7086:Kcnip1 UTSW 11 33634629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAGACAAACTTGCTCAG -3'
(R):5'- CCTCTGTTTAGCTAGAGGAACC -3'

Sequencing Primer
(F):5'- CTTGCTCAGTATGTACACAGATGC -3'
(R):5'- CTGTTTAGCTAGAGGAACCCTAATC -3'
Posted On2019-09-13