Incidental Mutation 'R7363:Ppp2r5c'
ID571491
Institutional Source Beutler Lab
Gene Symbol Ppp2r5c
Ensembl Gene ENSMUSG00000017843
Gene Nameprotein phosphatase 2, regulatory subunit B', gamma
Synonyms2700063L20Rik, 2610043M05Rik, Band 8A, D12Bwg0916e, B56/PP2A gamma
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110447120-110583062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110522607 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 71 (A71T)
Ref Sequence ENSEMBL: ENSMUSP00000152865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084985] [ENSMUST00000109832] [ENSMUST00000220509] [ENSMUST00000221074] [ENSMUST00000221715]
Predicted Effect probably benign
Transcript: ENSMUST00000084985
AA Change: A71T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000082053
Gene: ENSMUSG00000017843
AA Change: A71T

DomainStartEndE-ValueType
Pfam:B56 27 437 1.6e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109832
AA Change: A71T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105458
Gene: ENSMUSG00000017843
AA Change: A71T

DomainStartEndE-ValueType
Pfam:B56 26 438 3e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220509
AA Change: A128T

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000221074
AA Change: A71T

PolyPhen 2 Score 0.157 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221715
AA Change: A71T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trapped allele show partial neonatal lethality, hypoactivity, and abnormal ventricular septum formation associated with increased fetal cardiomyocyte apoptosis. Surviving homozygotes develop obesity and show an abnormal gait, decreased grip strength, and impaired balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Ppp2r5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Ppp2r5c APN 12 110567827 missense probably benign 0.09
IGL01743:Ppp2r5c APN 12 110580434 missense probably benign 0.00
IGL01866:Ppp2r5c APN 12 110567827 missense probably benign 0.24
IGL02883:Ppp2r5c APN 12 110522563 missense possibly damaging 0.48
IGL02944:Ppp2r5c APN 12 110567800 missense probably benign 0.02
FR4976:Ppp2r5c UTSW 12 110540738 intron probably null
R0020:Ppp2r5c UTSW 12 110574823 nonsense probably null
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0069:Ppp2r5c UTSW 12 110567770 missense probably benign 0.01
R0456:Ppp2r5c UTSW 12 110522579 missense probably damaging 0.99
R1521:Ppp2r5c UTSW 12 110554886 missense probably damaging 1.00
R1697:Ppp2r5c UTSW 12 110545623 nonsense probably null
R1697:Ppp2r5c UTSW 12 110561472 splice site probably benign
R2248:Ppp2r5c UTSW 12 110485923 missense probably benign 0.00
R3817:Ppp2r5c UTSW 12 110544187 critical splice donor site probably null
R4491:Ppp2r5c UTSW 12 110580522 missense possibly damaging 0.69
R5575:Ppp2r5c UTSW 12 110552832 missense probably damaging 1.00
R5828:Ppp2r5c UTSW 12 110570700 missense probably benign 0.01
R6059:Ppp2r5c UTSW 12 110574788 missense probably benign
R6351:Ppp2r5c UTSW 12 110554879 missense probably damaging 1.00
R6807:Ppp2r5c UTSW 12 110569022 missense possibly damaging 0.80
R6976:Ppp2r5c UTSW 12 110544145 missense probably damaging 1.00
R7236:Ppp2r5c UTSW 12 110465889 missense probably benign 0.01
R7360:Ppp2r5c UTSW 12 110574838 missense probably benign
R7467:Ppp2r5c UTSW 12 110552883 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATGTGGGTTAAGCATCG -3'
(R):5'- AGAACAGATGACATCTCCTGACAG -3'

Sequencing Primer
(F):5'- TAAGCATCGTTGTGACTGACAGC -3'
(R):5'- AGGAGCTGTTTGCATTCGCTTAAC -3'
Posted On2019-09-13