Incidental Mutation 'R0646:Slco1a1'
Institutional Source Beutler Lab
Gene Symbol Slco1a1
Ensembl Gene ENSMUSG00000041698
Gene Namesolute carrier organic anion transporter family, member 1a1
SynonymsOatp1, Slc21a1, Oatp1a1
MMRRC Submission 038831-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R0646 (G1)
Quality Score225
Status Validated
Chromosomal Location141907282-141946962 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 141925754 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042119] [ENSMUST00000168119]
Predicted Effect probably benign
Transcript: ENSMUST00000042119
SMART Domains Protein: ENSMUSP00000037022
Gene: ENSMUSG00000041698

Pfam:OATP 21 597 6e-168 PFAM
Pfam:MFS_1 22 410 4.7e-28 PFAM
Pfam:Kazal_2 445 486 1.2e-10 PFAM
transmembrane domain 600 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168119
SMART Domains Protein: ENSMUSP00000132386
Gene: ENSMUSG00000041698

Pfam:OATP 21 597 1.6e-168 PFAM
Pfam:MFS_1 22 410 1e-27 PFAM
Pfam:Kazal_2 445 486 4.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171651
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired organic anion transporter activity and urinary metabolomic profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik C T 11: 23,575,491 R716H probably damaging Het
4930432E11Rik C T 7: 29,561,285 noncoding transcript Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Abcb11 A G 2: 69,285,283 I579T probably damaging Het
Abcc9 T C 6: 142,682,104 N400S probably benign Het
Adarb2 T C 13: 8,731,819 L577P probably damaging Het
Agt A C 8: 124,557,113 N422K probably damaging Het
Ahnak A T 19: 9,013,402 K4017* probably null Het
Akap13 C A 7: 75,747,746 Q2575K probably damaging Het
Aldh3a2 A T 11: 61,253,715 I339K probably damaging Het
Alox15 G T 11: 70,345,624 Y483* probably null Het
Ampd1 A T 3: 103,099,597 I713F probably damaging Het
Amph A T 13: 19,113,116 E344V possibly damaging Het
Arid5b A G 10: 68,096,977 S1032P probably damaging Het
Armc8 C A 9: 99,505,688 L393F probably damaging Het
Bpnt1 A G 1: 185,345,426 probably null Het
Cachd1 G A 4: 100,988,221 R970H probably damaging Het
Cd207 T C 6: 83,675,756 T131A probably benign Het
Cd83 G A 13: 43,797,533 V54I probably benign Het
Cfap43 T C 19: 47,763,676 K1086E probably benign Het
Cfap65 A T 1: 74,902,169 V1837E probably benign Het
Clcnka T A 4: 141,396,606 H89L probably benign Het
Cnga4 T C 7: 105,404,975 I50T possibly damaging Het
Cog5 A G 12: 31,837,359 probably benign Het
Col11a2 T A 17: 34,059,348 probably null Het
Col28a1 T G 6: 8,175,291 I186L possibly damaging Het
Col4a2 T A 8: 11,431,252 M808K probably benign Het
Copb2 A G 9: 98,563,475 probably benign Het
Dbnl G A 11: 5,795,441 probably benign Het
Dbx2 T C 15: 95,654,612 T51A possibly damaging Het
Dcp1a A T 14: 30,502,885 M123L probably damaging Het
Ddx42 T A 11: 106,232,833 F217I probably benign Het
Dlc1 T C 8: 36,858,051 T367A probably benign Het
Dmgdh A T 13: 93,752,355 T834S probably benign Het
Dnah8 T C 17: 30,684,173 S929P probably damaging Het
Dnase1l2 C A 17: 24,441,082 V271L possibly damaging Het
Dsc1 T C 18: 20,096,057 Y392C probably damaging Het
Edn1 T C 13: 42,305,242 probably benign Het
Eps8l3 T C 3: 107,884,810 L351P probably damaging Het
F12 G A 13: 55,422,483 probably benign Het
Fam47e T C 5: 92,578,458 probably benign Het
Fcrl5 C A 3: 87,442,013 Q32K probably benign Het
Fndc1 C T 17: 7,741,673 V1637I possibly damaging Het
Foxg1 G T 12: 49,384,567 probably benign Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Galnt5 A T 2: 57,999,085 K232N probably benign Het
Ggt5 G A 10: 75,602,648 V68M probably damaging Het
Gm11639 G A 11: 104,720,501 D390N probably benign Het
Gm13084 A C 4: 143,812,585 S113A possibly damaging Het
Gm16519 T C 17: 70,929,106 C17R probably benign Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gm884 T A 11: 103,613,160 K485* probably null Het
Gm9631 T G 11: 121,945,629 D28A probably damaging Het
Gpx2 T C 12: 76,795,313 I21M probably benign Het
H2-Q2 T G 17: 35,345,685 D354E probably damaging Het
Icam2 A T 11: 106,380,891 I71K probably damaging Het
Il12a T C 3: 68,697,890 probably benign Het
Insm2 C G 12: 55,600,440 A323G probably benign Het
Itga1 T C 13: 114,968,299 T1064A probably benign Het
Itgad T A 7: 128,174,004 V11E possibly damaging Het
Kctd15 C T 7: 34,644,881 S115N probably damaging Het
Klra5 A G 6: 129,903,564 W124R probably damaging Het
Kng2 T A 16: 22,987,736 D571V probably benign Het
Kpna6 A T 4: 129,650,790 F380I probably benign Het
Lipo1 A T 19: 33,784,769 Y109* probably null Het
Man2a2 T C 7: 80,363,197 H540R possibly damaging Het
Map2k4 T C 11: 65,712,275 E188G probably damaging Het
Mast4 T C 13: 102,758,744 probably benign Het
Mbtd1 A G 11: 93,905,212 D25G probably damaging Het
Med13 T A 11: 86,331,089 Q238L possibly damaging Het
Mmachc A G 4: 116,703,654 Y215H probably damaging Het
Mtor T A 4: 148,484,354 Y1110* probably null Het
Nek2 A G 1: 191,822,219 N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,515,693 probably null Het
Neo1 G T 9: 58,931,034 T489K probably damaging Het
Neu1 T A 17: 34,934,760 Y387N probably damaging Het
Nfasc A T 1: 132,608,438 C586* probably null Het
Nle1 G A 11: 82,904,845 L259F probably damaging Het
Nrde2 G A 12: 100,143,846 Q309* probably null Het
Nufip2 C T 11: 77,686,453 H76Y probably benign Het
Olfr1330 A C 4: 118,893,490 T136P probably damaging Het
Olfr1383 A T 11: 49,524,578 N285I probably damaging Het
Olfr466 A T 13: 65,153,063 I280F probably damaging Het
Olfr584 T C 7: 103,086,151 F206S probably damaging Het
Olfr670 A T 7: 104,959,811 I307N probably benign Het
Olfr731 A T 14: 50,238,639 I82N probably damaging Het
Pcdhb5 A G 18: 37,321,622 T352A probably benign Het
Pcdhb7 A T 18: 37,343,389 D526V probably damaging Het
Phkg1 A T 5: 129,864,553 probably null Het
Plg C T 17: 12,418,736 T744M probably damaging Het
Plxnd1 A C 6: 115,958,699 probably benign Het
Poglut1 A T 16: 38,529,475 I312N probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppt1 A G 4: 122,844,099 M77V probably benign Het
Pramel5 G T 4: 144,271,620 T351N probably damaging Het
Psmb4 G A 3: 94,884,964 R216C probably benign Het
Ptprd T C 4: 76,084,403 T699A probably damaging Het
Retreg3 A T 11: 101,098,629 probably benign Het
Scaper G A 9: 55,758,056 A389V probably damaging Het
Serinc5 G A 13: 92,688,737 D225N possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sod3 A T 5: 52,368,079 D40V probably benign Het
Sorcs3 C A 19: 48,206,295 A39E probably benign Het
Spon1 A T 7: 114,039,821 T761S probably benign Het
Syde2 A G 3: 146,014,249 probably null Het
Synm T A 7: 67,759,168 D154V probably benign Het
Synpo2 T C 3: 123,114,449 E406G probably damaging Het
Tcea3 T A 4: 136,248,071 L8* probably null Het
Tec G A 5: 72,823,497 L33F probably damaging Het
Tex15 T A 8: 33,582,326 S2634T possibly damaging Het
Tg T A 15: 66,729,626 Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 V853I probably benign Het
Togaram1 A G 12: 65,021,466 K1748E probably damaging Het
Ttn T C 2: 76,898,478 probably benign Het
Usp36 C T 11: 118,273,021 D234N probably damaging Het
Usp40 G A 1: 87,978,522 P664S probably benign Het
Vmn1r54 T A 6: 90,269,653 L183H probably benign Het
Vmn1r58 T G 7: 5,410,677 I185L probably benign Het
Wnt8a A T 18: 34,547,565 R328W probably benign Het
Yars A G 4: 129,213,939 probably benign Het
Zbtb49 A C 5: 38,200,674 M745R probably damaging Het
Zeb1 T G 18: 5,759,027 F162V probably damaging Het
Zfp369 A T 13: 65,297,548 H835L probably damaging Het
Zic5 A G 14: 122,463,939 V460A unknown Het
Zp3 A G 5: 135,984,356 N181D possibly damaging Het
Other mutations in Slco1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slco1a1 APN 6 141909125 missense probably damaging 0.98
IGL00942:Slco1a1 APN 6 141946628 missense probably benign 0.00
IGL01301:Slco1a1 APN 6 141932530 splice site probably benign
IGL01306:Slco1a1 APN 6 141946587 nonsense probably null
IGL01774:Slco1a1 APN 6 141925613 nonsense probably null
IGL02097:Slco1a1 APN 6 141940039 missense possibly damaging 0.94
IGL02183:Slco1a1 APN 6 141921943 splice site probably benign
IGL02376:Slco1a1 APN 6 141924334 critical splice donor site probably null
IGL02550:Slco1a1 APN 6 141943465 missense probably benign 0.24
IGL02559:Slco1a1 APN 6 141921788 missense probably benign 0.01
IGL02825:Slco1a1 APN 6 141918617 missense probably damaging 1.00
IGL03352:Slco1a1 APN 6 141911885 missense probably benign 0.00
ANU23:Slco1a1 UTSW 6 141946587 nonsense probably null
R0041:Slco1a1 UTSW 6 141918459 splice site probably benign
R0153:Slco1a1 UTSW 6 141910701 splice site probably benign
R0610:Slco1a1 UTSW 6 141918461 critical splice donor site probably null
R0828:Slco1a1 UTSW 6 141921839 missense possibly damaging 0.89
R1674:Slco1a1 UTSW 6 141935935 missense probably damaging 0.99
R1848:Slco1a1 UTSW 6 141923111 missense probably benign 0.29
R3834:Slco1a1 UTSW 6 141943437 missense possibly damaging 0.94
R3953:Slco1a1 UTSW 6 141923107 missense probably damaging 1.00
R3974:Slco1a1 UTSW 6 141909093 missense probably benign 0.01
R4081:Slco1a1 UTSW 6 141935962 missense probably damaging 0.99
R4729:Slco1a1 UTSW 6 141908969 missense probably benign 0.00
R4752:Slco1a1 UTSW 6 141946614 missense possibly damaging 0.80
R4806:Slco1a1 UTSW 6 141909009 missense possibly damaging 0.76
R4812:Slco1a1 UTSW 6 141918593 missense probably damaging 1.00
R4963:Slco1a1 UTSW 6 141923099 missense probably benign 0.26
R5641:Slco1a1 UTSW 6 141939969 missense probably damaging 1.00
R6044:Slco1a1 UTSW 6 141940017 missense probably benign 0.01
R6211:Slco1a1 UTSW 6 141909049 missense probably benign 0.20
R6225:Slco1a1 UTSW 6 141924489 missense possibly damaging 0.70
R6328:Slco1a1 UTSW 6 141932450 missense probably damaging 1.00
R6428:Slco1a1 UTSW 6 141925690 missense probably damaging 1.00
R6787:Slco1a1 UTSW 6 141936487 missense probably benign 0.00
R7182:Slco1a1 UTSW 6 141911839 missense probably damaging 1.00
R7305:Slco1a1 UTSW 6 141924497 missense probably damaging 1.00
R7328:Slco1a1 UTSW 6 141936408 missense possibly damaging 0.94
R7723:Slco1a1 UTSW 6 141909069 missense probably damaging 0.97
R7784:Slco1a1 UTSW 6 141943388 missense probably damaging 0.99
R8348:Slco1a1 UTSW 6 141940061 missense possibly damaging 0.79
R8448:Slco1a1 UTSW 6 141940061 missense possibly damaging 0.79
R8856:Slco1a1 UTSW 6 141911898 missense probably damaging 1.00
Z1177:Slco1a1 UTSW 6 141940018 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccagcacatgggaaaagataaag -3'
Posted On2013-07-11