Mutagenetix > Incidental Mutation

Incidental Mutation 'R7363:Zfpm2'

571500

Institutional Source

Beutler Lab

Gene Symbol

Zfpm2

Ensembl Gene

ENSMUSG00000022306

Gene Name

zinc finger protein, multitype 2

Synonyms

B330005D23Rik, FOG2, FOG-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7363 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40655035-41104592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40753017 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 54 (N54K)

Ref Sequence

ENSEMBL: ENSMUSP00000051335 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053467] [ENSMUST00000230319]

AlphaFold

Q8CCH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000053467
AA Change: N54K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000051335
Gene: ENSMUSG00000022306
AA Change: N54K

Domain	Start	End	E-Value	Type
low complexity region	19	35	N/A	INTRINSIC
ZnF_C2H2	250	270	4.27e1	SMART
ZnF_C2H2	296	320	1.25e-1	SMART
ZnF_C2H2	335	357	4.05e-1	SMART
ZnF_C2H2	363	385	6.23e-2	SMART
ZnF_C2H2	548	569	1.43e1	SMART
ZnF_C2H2	687	714	1.06e2	SMART
low complexity region	731	741	N/A	INTRINSIC
ZnF_C2H2	854	874	5.4e1	SMART
ZnF_C2H2	1119	1145	4.99e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000230319

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zinc finger protein encoded by this gene is a widely expressed member of the FOG family of transcription factors. The family members modulate the activity of GATA family proteins, which are important regulators of hematopoiesis and cardiogenesis in mammals. It has been demonstrated that the protein can both activate and down-regulate expression of GATA-target genes, suggesting different modulation in different promoter contexts. A related mRNA suggests an alternatively spliced product but this information is not yet fully supported by the sequence. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac defects, including absence of coronary vasculature, resulting in lethality between E12.5 and E15.5. Conditional mutations reveal errors in ovary and testis development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,770	N190I	probably damaging	Het
Ablim1	G	T	19: 57,215,741	L73I	probably benign	Het
Adamts4	A	T	1: 171,259,039	Q800L	probably benign	Het
Atm	A	T	9: 53,465,298	I2014N	probably damaging	Het
Atp2a1	A	G	7: 126,462,889	C12R	possibly damaging	Het
B3galnt1	A	T	3: 69,575,824	Y35N	probably damaging	Het
Bnc2	A	T	4: 84,292,071	M687K	probably benign	Het
Cacna2d4	A	G	6: 119,343,978	Y917C	probably damaging	Het
Ces2e	A	G	8: 104,933,000		probably null	Het
Cldn23	A	G	8: 35,825,505		probably null	Het
Cntn5	G	T	9: 10,172,016	S54R	probably benign	Het
Dido1	G	T	2: 180,662,517	S1198*	probably null	Het
Dnah12	A	G	14: 26,724,611	M776V	probably benign	Het
Dnah14	A	G	1: 181,690,524		probably null	Het
Dnttip1	GGGCCGGC	GGGC	2: 164,757,685		probably null	Het
Dusp28	A	T	1: 92,907,139	T29S	probably benign	Het
Erich1	A	T	8: 14,033,688	S127R	probably benign	Het
Fam151a	T	A	4: 106,745,484	L200H	probably damaging	Het
Fam49a	T	A	12: 12,340,664		probably null	Het
Fam71a	A	T	1: 191,163,713	S244R	probably damaging	Het
Fbxw8	A	T	5: 118,124,992	H207Q	probably damaging	Het
Fgf22	A	G	10: 79,756,842	E116G	probably benign	Het
Gapvd1	C	A	2: 34,712,195	V647F	probably benign	Het
Gja4	T	A	4: 127,312,694	Y92F	probably damaging	Het
Gtf3c2	G	A	5: 31,170,256	R288W	probably damaging	Het
Hira	G	T	16: 18,897,782	R99L	possibly damaging	Het
Ighv16-1	C	T	12: 114,069,101	G27D	probably damaging	Het
Igkv1-133	C	T	6: 67,725,411	P38S	probably benign	Het
Igkv4-59	T	C	6: 69,438,412	Y53C	probably damaging	Het
Il23a	T	C	10: 128,297,151	E113G	probably damaging	Het
Kcnip1	A	G	11: 33,634,589	V188A	probably benign	Het
L3mbtl3	T	C	10: 26,340,952	K155E	unknown	Het
Lancl2	T	G	6: 57,722,679	C169G	probably benign	Het
Lrrc26	A	G	2: 25,290,569	D194G	probably benign	Het
Lrrfip1	C	T	1: 91,123,120	A545V	probably benign	Het
Lrtm1	T	C	14: 29,021,893	F106S	probably damaging	Het
Lypd2	A	T	15: 74,732,999	M49K	probably damaging	Het
Mbd1	A	C	18: 74,273,286	D63A	probably damaging	Het
Mdn1	T	C	4: 32,691,729	F990L	probably damaging	Het
Mtfr1l	T	C	4: 134,529,266	E196G	probably benign	Het
Myh10	A	G	11: 68,815,048	T2007A	probably benign	Het
Nckap1	G	A	2: 80,540,168	R393C	probably damaging	Het
Nup205	C	T	6: 35,232,573	T1605M	probably benign	Het
Olfr1052	GTACTTTTT	GT	2: 86,297,994		probably null	Het
Olfr393	T	C	11: 73,847,915	D70G	probably damaging	Het
Pgap2	T	A	7: 102,226,260		probably null	Het
Pitrm1	A	G	13: 6,569,351	S741G	probably benign	Het
Plcd4	A	T	1: 74,551,072	S155C	probably null	Het
Poc5	A	T	13: 96,404,417	T365S	possibly damaging	Het
Ppp2r5c	G	A	12: 110,522,607	A71T	probably benign	Het
Prdm6	T	A	18: 53,465,127	I187N	possibly damaging	Het
Pxk	A	G	14: 8,152,118	Q478R	probably benign	Het
Rgl1	T	C	1: 152,519,163	Y718C	probably damaging	Het
Ring1	G	T	17: 34,024,362	T2K	possibly damaging	Het
Sdk1	A	G	5: 142,188,142	S2022G	probably benign	Het
Sec61a1	C	A	6: 88,515,551	V32F	probably benign	Het
Sv2b	G	A	7: 75,147,654	P331S	probably damaging	Het
Syne1	T	C	10: 5,140,970	S795G	possibly damaging	Het
Tmem2	T	C	19: 21,856,211	F1338L	probably benign	Het
Tmod2	T	C	9: 75,576,741	E309G	probably damaging	Het
Tpp2	T	G	1: 43,985,422	S987A	probably benign	Het
Trim75	G	C	8: 64,982,887	H304D	probably damaging	Het
Trp53bp2	G	T	1: 182,444,666	D447Y	probably damaging	Het
Ube3a	A	G	7: 59,287,003	K697E	probably benign	Het
Vmn2r13	T	A	5: 109,192,043	H22L	probably benign	Het
Vmn2r4	G	A	3: 64,407,011	S183F	probably damaging	Het
Vwa8	T	C	14: 79,018,707	Y721H	probably benign	Het
Wbp1l	C	T	19: 46,654,130	P190L	possibly damaging	Het
Zcchc4	A	T	5: 52,785,168	Q105L	possibly damaging	Het
Zfp236	T	C	18: 82,621,331	R1264G	probably damaging	Het
Zkscan3	C	T	13: 21,387,822	G547S	probably damaging	Het

Other mutations in Zfpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zfpm2	APN	15	41099287	missense	probably damaging	1.00
IGL00815:Zfpm2	APN	15	41099491	missense	probably benign	0.37
IGL00821:Zfpm2	APN	15	41103387	missense	probably damaging	1.00
IGL01622:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01623:Zfpm2	APN	15	41101924	missense	probably benign	0.07
IGL01807:Zfpm2	APN	15	40753056	critical splice donor site	probably null
IGL01872:Zfpm2	APN	15	41102387	missense	probably benign
IGL02087:Zfpm2	APN	15	41103121	missense	probably damaging	0.97
IGL02123:Zfpm2	APN	15	41102195	missense	probably damaging	1.00
IGL02355:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02362:Zfpm2	APN	15	41099494	missense	probably damaging	1.00
IGL02579:Zfpm2	APN	15	41099472	missense	possibly damaging	0.91
IGL02752:Zfpm2	APN	15	41102019	missense	probably benign	0.23
IGL02792:Zfpm2	APN	15	41103013	missense	probably benign	0.00
IGL02861:Zfpm2	APN	15	41103266	missense	probably damaging	0.98
IGL03180:Zfpm2	APN	15	41101394	missense	probably damaging	1.00
IGL03344:Zfpm2	APN	15	41102774	missense	probably benign
R0305:Zfpm2	UTSW	15	40774035	splice site	probably benign
R0365:Zfpm2	UTSW	15	40774066	missense	possibly damaging	0.88
R1171:Zfpm2	UTSW	15	41101679	missense	probably damaging	1.00
R1456:Zfpm2	UTSW	15	41102481	missense	probably damaging	1.00
R1482:Zfpm2	UTSW	15	41099291	missense	probably damaging	1.00
R1580:Zfpm2	UTSW	15	41103209	missense	possibly damaging	0.84
R2119:Zfpm2	UTSW	15	41103023	missense	probably damaging	1.00
R2189:Zfpm2	UTSW	15	41101183	missense	possibly damaging	0.76
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2867:Zfpm2	UTSW	15	41099389	missense	probably benign	0.06
R2886:Zfpm2	UTSW	15	41102323	missense	probably benign	0.44
R3024:Zfpm2	UTSW	15	41102959	missense	probably benign	0.00
R4043:Zfpm2	UTSW	15	40870627	missense	possibly damaging	0.94
R4178:Zfpm2	UTSW	15	41103544	missense	probably damaging	1.00
R4465:Zfpm2	UTSW	15	41096161	missense	probably benign	0.00
R5263:Zfpm2	UTSW	15	41099395	missense	probably benign	0.45
R5266:Zfpm2	UTSW	15	41099469	missense	probably benign	0.01
R5352:Zfpm2	UTSW	15	40870542	missense	probably benign	0.01
R5584:Zfpm2	UTSW	15	41102537	missense	probably benign	0.45
R5661:Zfpm2	UTSW	15	41096071	nonsense	probably null
R6437:Zfpm2	UTSW	15	41099397	missense	probably benign
R6660:Zfpm2	UTSW	15	40655585	critical splice donor site	probably null
R6742:Zfpm2	UTSW	15	41101718	missense	probably benign
R6749:Zfpm2	UTSW	15	40954708	missense	possibly damaging	0.90
R7401:Zfpm2	UTSW	15	41102990	missense	possibly damaging	0.87
R7657:Zfpm2	UTSW	15	41103275	missense	possibly damaging	0.78
R7690:Zfpm2	UTSW	15	40954766	missense	possibly damaging	0.45
R7698:Zfpm2	UTSW	15	41096091	missense	probably benign	0.03
R7893:Zfpm2	UTSW	15	41102612	missense	probably damaging	1.00
R8081:Zfpm2	UTSW	15	41102248	missense	probably damaging	1.00
R8223:Zfpm2	UTSW	15	40752959	missense	probably benign	0.34
R9028:Zfpm2	UTSW	15	41103362	missense	possibly damaging	0.87
R9065:Zfpm2	UTSW	15	41099316	missense	possibly damaging	0.95
R9234:Zfpm2	UTSW	15	41103074	missense	probably damaging	1.00
R9474:Zfpm2	UTSW	15	41103471	missense	probably damaging	1.00
R9694:Zfpm2	UTSW	15	41102314	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCTTTCTCACCTTGGAAATCAAAAC -3'
(R):5'- TAACTCAGGGAACGTGCCAAC -3'

Sequencing Primer
(F):5'- ACTCCGCTTAAAGGACTTTTATTTC -3'
(R):5'- GTTTATTCCAATGACAAAAGAGCTTC -3'

Posted On

2019-09-13