Incidental Mutation 'R7363:Hira'
ID571502
Institutional Source Beutler Lab
Gene Symbol Hira
Ensembl Gene ENSMUSG00000022702
Gene Namehistone cell cycle regulator
SynonymsD16Ertd95e, Gm15797, Tuple1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location18877037-18970309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18897782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 99 (R99L)
Ref Sequence ENSEMBL: ENSMUSP00000004222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000120532] [ENSMUST00000128321] [ENSMUST00000144609] [ENSMUST00000153397] [ENSMUST00000190050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004222
AA Change: R99L

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: R99L

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120532
AA Change: R55L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112614
Gene: ENSMUSG00000022702
AA Change: R55L

DomainStartEndE-ValueType
WD40 15 54 9.67e-7 SMART
WD40 76 115 3.58e-10 SMART
WD40 119 158 7.22e-6 SMART
WD40 168 210 9.17e1 SMART
WD40 213 269 1.54e0 SMART
WD40 275 312 2.86e0 SMART
low complexity region 361 368 N/A INTRINSIC
Pfam:HIRA_B 404 427 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128321
Predicted Effect probably benign
Transcript: ENSMUST00000144609
Predicted Effect probably benign
Transcript: ENSMUST00000153397
SMART Domains Protein: ENSMUSP00000117944
Gene: ENSMUSG00000022702

DomainStartEndE-ValueType
Blast:WD40 1 40 1e-18 BLAST
SCOP:d1erja_ 7 33 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Hira
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Hira APN 16 18946340 splice site probably benign
IGL01285:Hira APN 16 18912180 missense probably benign 0.01
F5770:Hira UTSW 16 18894821 missense probably damaging 1.00
IGL02796:Hira UTSW 16 18925654 missense probably benign 0.01
R0123:Hira UTSW 16 18956171 missense probably benign 0.45
R0225:Hira UTSW 16 18956171 missense probably benign 0.45
R0606:Hira UTSW 16 18935047 missense probably benign 0.00
R1017:Hira UTSW 16 18899347 intron probably null
R1456:Hira UTSW 16 18925663 missense probably benign 0.02
R1479:Hira UTSW 16 18896469 missense probably damaging 1.00
R1731:Hira UTSW 16 18933014 missense probably benign 0.01
R1830:Hira UTSW 16 18947414 missense probably damaging 1.00
R2039:Hira UTSW 16 18951701 missense probably benign 0.05
R4328:Hira UTSW 16 18896612 missense probably benign 0.01
R4401:Hira UTSW 16 18925720 missense probably damaging 1.00
R4423:Hira UTSW 16 18956202 missense possibly damaging 0.80
R4634:Hira UTSW 16 18946400 missense probably damaging 0.98
R4728:Hira UTSW 16 18922904 missense probably damaging 1.00
R5050:Hira UTSW 16 18925859 missense possibly damaging 0.75
R5139:Hira UTSW 16 18954758 missense probably damaging 1.00
R5201:Hira UTSW 16 18952115 missense probably damaging 0.98
R5327:Hira UTSW 16 18954758 missense probably damaging 1.00
R5483:Hira UTSW 16 18969540 missense possibly damaging 0.89
R5573:Hira UTSW 16 18916599 missense probably damaging 1.00
R5626:Hira UTSW 16 18927512 missense probably damaging 0.97
R5768:Hira UTSW 16 18935018 splice site probably benign
R5952:Hira UTSW 16 18935065 missense possibly damaging 0.83
R6128:Hira UTSW 16 18932977 missense probably benign 0.08
R6280:Hira UTSW 16 18910707 missense probably damaging 1.00
R7116:Hira UTSW 16 18912114 missense probably damaging 1.00
R7497:Hira UTSW 16 18952079 missense probably damaging 0.99
V7581:Hira UTSW 16 18894821 missense probably damaging 1.00
V7582:Hira UTSW 16 18894821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAATTGTTTCTCTGCGACTCATAC -3'
(R):5'- AAGCCTCCGAGTCACTTGTC -3'

Sequencing Primer
(F):5'- TCTCTGCGACTCATACACAGTAAATG -3'
(R):5'- GAGTCACTTGTCAGGCTTCATC -3'
Posted On2019-09-13