Incidental Mutation 'R7363:Wbp1l'
ID571508
Institutional Source Beutler Lab
Gene Symbol Wbp1l
Ensembl Gene ENSMUSG00000047731
Gene NameWW domain binding protein 1 like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7363 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location46599084-46657389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46654130 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 190 (P190L)
Ref Sequence ENSEMBL: ENSMUSP00000096975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099376] [ENSMUST00000111855] [ENSMUST00000132202] [ENSMUST00000138302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099376
AA Change: P190L

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096975
Gene: ENSMUSG00000047731
AA Change: P190L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 59 160 1.2e-52 PFAM
low complexity region 163 214 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111855
AA Change: P153L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107486
Gene: ENSMUSG00000047731
AA Change: P153L

DomainStartEndE-ValueType
Pfam:WBP-1 22 123 1.1e-52 PFAM
low complexity region 126 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132202
SMART Domains Protein: ENSMUSP00000121821
Gene: ENSMUSG00000047731

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 72 1.7e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000138302
AA Change: P174L

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117929
Gene: ENSMUSG00000047731
AA Change: P174L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:WBP-1 43 144 1.2e-52 PFAM
low complexity region 147 198 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Ces2e A G 8: 104,933,000 probably null Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnah14 A G 1: 181,690,524 probably null Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam49a T A 12: 12,340,664 probably null Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nckap1 G A 2: 80,540,168 R393C probably damaging Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pgap2 T A 7: 102,226,260 probably null Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Wbp1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Wbp1l APN 19 46644369 missense probably damaging 1.00
IGL01602:Wbp1l APN 19 46654400 missense possibly damaging 0.92
IGL01605:Wbp1l APN 19 46654400 missense possibly damaging 0.92
IGL01820:Wbp1l APN 19 46652483 missense probably damaging 1.00
IGL02058:Wbp1l APN 19 46652520 nonsense probably null
IGL02117:Wbp1l APN 19 46644437 missense probably benign 0.26
IGL02245:Wbp1l APN 19 46654618 missense possibly damaging 0.52
IGL02321:Wbp1l APN 19 46654310 missense probably benign 0.01
IGL03126:Wbp1l APN 19 46644399 missense probably damaging 0.96
PIT4810001:Wbp1l UTSW 19 46654322 missense probably benign 0.07
R0610:Wbp1l UTSW 19 46654670 missense probably damaging 1.00
R1636:Wbp1l UTSW 19 46644444 missense probably damaging 1.00
R3978:Wbp1l UTSW 19 46653957 splice site probably null
R3980:Wbp1l UTSW 19 46653957 splice site probably null
R5387:Wbp1l UTSW 19 46644457 critical splice donor site probably null
R5524:Wbp1l UTSW 19 46654256 missense possibly damaging 0.94
R5889:Wbp1l UTSW 19 46654180 nonsense probably null
R5935:Wbp1l UTSW 19 46654180 nonsense probably null
R5942:Wbp1l UTSW 19 46654430 missense probably damaging 1.00
R5964:Wbp1l UTSW 19 46654180 nonsense probably null
R5966:Wbp1l UTSW 19 46654180 nonsense probably null
R6480:Wbp1l UTSW 19 46654319 missense probably damaging 0.96
R7290:Wbp1l UTSW 19 46623437 intron probably benign
R7297:Wbp1l UTSW 19 46654400 missense possibly damaging 0.92
R8493:Wbp1l UTSW 19 46652549 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTAGAGTGCTGACCCATGTGG -3'
(R):5'- TTGCACTCGGAATCCTGGTC -3'

Sequencing Primer
(F):5'- ATGTGGTAATTTCTTCTCCCACCTG -3'
(R):5'- CTGGTCCAGGAAGGCGC -3'
Posted On2019-09-13