Incidental Mutation 'R7278:Cps1'
ID571513
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Namecarbamoyl-phosphate synthetase 1
SynonymsCPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location67123026-67231259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67170921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 637 (V637I)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
Predicted Effect probably damaging
Transcript: ENSMUST00000027144
AA Change: V637I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: V637I

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67152380 splice site probably benign
IGL00897:Cps1 APN 1 67215564 missense probably benign 0.08
IGL00928:Cps1 APN 1 67123234 missense probably benign
IGL01063:Cps1 APN 1 67195166 missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67206824 missense probably damaging 1.00
IGL01361:Cps1 APN 1 67195145 missense probably benign 0.03
IGL01396:Cps1 APN 1 67157786 missense probably damaging 1.00
IGL01516:Cps1 APN 1 67230284 missense probably damaging 0.99
IGL01695:Cps1 APN 1 67197035 missense probably benign
IGL02022:Cps1 APN 1 67172872 splice site probably benign
IGL02032:Cps1 APN 1 67230315 missense probably benign 0.03
IGL02049:Cps1 APN 1 67143954 missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67157764 missense probably benign
IGL02217:Cps1 APN 1 67174382 missense probably benign 0.06
IGL02555:Cps1 APN 1 67214021 missense probably benign 0.06
IGL02570:Cps1 APN 1 67148703 splice site probably benign
IGL02633:Cps1 APN 1 67123237 missense probably benign
IGL02711:Cps1 APN 1 67212517 splice site probably benign
IGL02737:Cps1 APN 1 67148774 missense probably benign 0.35
IGL03030:Cps1 APN 1 67142921 missense probably damaging 1.00
IGL03255:Cps1 APN 1 67145801 nonsense probably null
Madman UTSW 1 67160871 missense probably damaging 0.96
maniac UTSW 1 67157878 critical splice donor site probably null
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67229418 missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67180116 missense probably benign
R0318:Cps1 UTSW 1 67177014 missense probably damaging 0.99
R0486:Cps1 UTSW 1 67165392 missense probably damaging 1.00
R0488:Cps1 UTSW 1 67148808 splice site probably benign
R0492:Cps1 UTSW 1 67157836 missense probably damaging 1.00
R0521:Cps1 UTSW 1 67215564 missense probably benign 0.02
R0534:Cps1 UTSW 1 67143900 missense probably benign 0.06
R0565:Cps1 UTSW 1 67166449 missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67172802 missense probably damaging 1.00
R0612:Cps1 UTSW 1 67139770 missense probably benign 0.01
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1185:Cps1 UTSW 1 67195199 missense probably benign 0.00
R1220:Cps1 UTSW 1 67204703 critical splice donor site probably null
R1321:Cps1 UTSW 1 67143019 splice site probably benign
R1343:Cps1 UTSW 1 67209609 missense probably damaging 1.00
R1373:Cps1 UTSW 1 67229424 missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1481:Cps1 UTSW 1 67143882 missense probably damaging 0.99
R1711:Cps1 UTSW 1 67168374 splice site probably null
R1712:Cps1 UTSW 1 67230281 missense probably damaging 0.97
R1774:Cps1 UTSW 1 67170882 missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67209642 missense probably damaging 1.00
R1954:Cps1 UTSW 1 67195196 missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67204638 missense probably benign 0.21
R2078:Cps1 UTSW 1 67157806 missense probably damaging 1.00
R2078:Cps1 UTSW 1 67195265 missense possibly damaging 0.74
R2111:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2112:Cps1 UTSW 1 67176980 missense probably benign 0.01
R2146:Cps1 UTSW 1 67152379 splice site probably benign
R2355:Cps1 UTSW 1 67156224 missense probably damaging 1.00
R2375:Cps1 UTSW 1 67217860 missense probably benign 0.00
R2860:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2861:Cps1 UTSW 1 67166375 missense probably benign 0.44
R2979:Cps1 UTSW 1 67204704 critical splice donor site probably null
R3427:Cps1 UTSW 1 67174494 missense probably damaging 1.00
R3833:Cps1 UTSW 1 67139787 missense probably damaging 1.00
R3857:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3858:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3859:Cps1 UTSW 1 67168278 missense probably damaging 1.00
R3886:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67165500 missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67170995 critical splice donor site probably null
R4497:Cps1 UTSW 1 67205199 missense probably null 1.00
R4671:Cps1 UTSW 1 67196560 missense probably damaging 1.00
R4774:Cps1 UTSW 1 67220512 missense probably damaging 0.99
R4799:Cps1 UTSW 1 67142986 missense probably damaging 0.96
R4853:Cps1 UTSW 1 67156202 missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67177024 missense probably benign 0.11
R4900:Cps1 UTSW 1 67160904 missense probably damaging 1.00
R4906:Cps1 UTSW 1 67139763 missense probably benign 0.10
R5091:Cps1 UTSW 1 67229520 critical splice donor site probably null
R5102:Cps1 UTSW 1 67206793 missense probably benign 0.00
R5215:Cps1 UTSW 1 67166380 missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67172709 missense probably benign 0.21
R5732:Cps1 UTSW 1 67157764 missense probably benign 0.22
R5818:Cps1 UTSW 1 67166488 missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67157878 critical splice donor site probably null
R6002:Cps1 UTSW 1 67172755 missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6034:Cps1 UTSW 1 67157713 splice site probably null
R6199:Cps1 UTSW 1 67162615 frame shift probably null
R6310:Cps1 UTSW 1 67142981 missense probably benign 0.00
R6554:Cps1 UTSW 1 67174469 nonsense probably null
R6700:Cps1 UTSW 1 67229523 splice site probably null
R6731:Cps1 UTSW 1 67160871 missense probably damaging 0.96
R7052:Cps1 UTSW 1 67198410 missense probably damaging 1.00
R7313:Cps1 UTSW 1 67198358 missense probably damaging 0.99
R7323:Cps1 UTSW 1 67157869 missense probably benign 0.03
R7339:Cps1 UTSW 1 67197015 missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67139857 missense probably damaging 1.00
R7505:Cps1 UTSW 1 67180081 missense probably benign
R7748:Cps1 UTSW 1 67139806 missense probably damaging 1.00
R7853:Cps1 UTSW 1 67174481 missense possibly damaging 0.92
R8097:Cps1 UTSW 1 67228270 missense probably benign 0.08
R8357:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8435:Cps1 UTSW 1 67212430 missense probably benign 0.07
R8457:Cps1 UTSW 1 67156854 missense probably damaging 1.00
R8680:Cps1 UTSW 1 67204613 missense probably damaging 1.00
R8805:Cps1 UTSW 1 67176951 missense probably damaging 1.00
R8811:Cps1 UTSW 1 67214087 missense probably benign 0.03
R8819:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
R8820:Cps1 UTSW 1 67228280 missense possibly damaging 0.56
X0024:Cps1 UTSW 1 67123247 missense probably benign
Z1176:Cps1 UTSW 1 67123268 missense possibly damaging 0.54
Z1176:Cps1 UTSW 1 67148719 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGACCAGCATGTAGGTCAG -3'
(R):5'- CTGTGAGTTCCAAACTAAAGGTGAG -3'

Sequencing Primer
(F):5'- CAGCATGTAGGTCAGAGCACTTTC -3'
(R):5'- AGTGTTATAATCAGTCCACCAAGG -3'
Posted On2019-09-13