Incidental Mutation 'R7278:Trp53bp1'
ID571524
Institutional Source Beutler Lab
Gene Symbol Trp53bp1
Ensembl Gene ENSMUSG00000043909
Gene Nametransformation related protein 53 binding protein 1
Synonyms53BP1, p53BP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7278 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121193281-121271407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121199035 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1838 (I1838N)
Ref Sequence ENSEMBL: ENSMUSP00000106277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000110647] [ENSMUST00000110648] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000154426] [ENSMUST00000186659]
Predicted Effect probably benign
Transcript: ENSMUST00000039541
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110647
AA Change: I1838N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106277
Gene: ENSMUSG00000043909
AA Change: I1838N

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
Pfam:53-BP1_Tudor 1430 1551 2.5e-80 PFAM
low complexity region 1581 1601 N/A INTRINSIC
BRCT 1673 1785 7.13e-1 SMART
BRCT 1813 1901 1.03e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110648
AA Change: I1888N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106278
Gene: ENSMUSG00000043909
AA Change: I1888N

DomainStartEndE-ValueType
low complexity region 136 149 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 647 661 N/A INTRINSIC
low complexity region 1031 1042 N/A INTRINSIC
low complexity region 1099 1112 N/A INTRINSIC
low complexity region 1260 1272 N/A INTRINSIC
low complexity region 1290 1332 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
Pfam:53-BP1_Tudor 1480 1601 1.5e-80 PFAM
low complexity region 1631 1651 N/A INTRINSIC
BRCT 1723 1835 7.13e-1 SMART
BRCT 1863 1951 1.03e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110657
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110658
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147540
Predicted Effect probably benign
Transcript: ENSMUST00000154426
SMART Domains Protein: ENSMUSP00000117548
Gene: ENSMUSG00000043909

DomainStartEndE-ValueType
Pfam:53-BP1_Tudor 1 70 2.5e-44 PFAM
low complexity region 100 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186659
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
MGI Phenotype PHENOTYPE: Homozygous mutations in this gene result in growth retardation, immunodeficiency, thymic hypoplasia, and increased incidence of thymic lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,476 L142P probably benign Het
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in Trp53bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Trp53bp1 APN 2 121256579 missense possibly damaging 0.69
IGL00690:Trp53bp1 APN 2 121235995 missense probably damaging 1.00
IGL00922:Trp53bp1 APN 2 121208482 missense probably damaging 0.96
IGL01475:Trp53bp1 APN 2 121270319 splice site probably null
IGL01639:Trp53bp1 APN 2 121202692 missense possibly damaging 0.51
IGL01662:Trp53bp1 APN 2 121236025 missense probably damaging 1.00
IGL01757:Trp53bp1 APN 2 121211304 missense probably damaging 0.99
IGL01829:Trp53bp1 APN 2 121215896 missense probably benign 0.39
IGL02247:Trp53bp1 APN 2 121236589 missense probably damaging 1.00
IGL02349:Trp53bp1 APN 2 121199074 missense probably damaging 1.00
IGL02391:Trp53bp1 APN 2 121202710 missense possibly damaging 0.67
chives UTSW 2 121251868 missense probably null 0.13
concur UTSW 2 121270319 splice site probably null
confirmation UTSW 2 121205113 critical splice acceptor site probably null
Infra UTSW 2 121247499 critical splice donor site probably null
lentil UTSW 2 121251868 missense probably null 0.13
lentil2 UTSW 2 121207887 missense probably damaging 1.00
Profundus UTSW 2 121207803 missense probably damaging 1.00
split_pea UTSW 2 121228606 nonsense probably null
verily UTSW 2 121211313 missense probably damaging 1.00
PIT1430001:Trp53bp1 UTSW 2 121271275 missense probably damaging 1.00
R0045:Trp53bp1 UTSW 2 121204497 missense probably benign
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0060:Trp53bp1 UTSW 2 121204525 missense probably damaging 1.00
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0103:Trp53bp1 UTSW 2 121236759 missense possibly damaging 0.92
R0281:Trp53bp1 UTSW 2 121270237 missense probably damaging 1.00
R0386:Trp53bp1 UTSW 2 121204943 missense probably damaging 1.00
R0427:Trp53bp1 UTSW 2 121236017 missense probably damaging 1.00
R0505:Trp53bp1 UTSW 2 121269969 missense probably damaging 0.99
R0522:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0523:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0525:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0543:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0559:Trp53bp1 UTSW 2 121227801 missense probably damaging 1.00
R0573:Trp53bp1 UTSW 2 121228172 splice site probably benign
R0593:Trp53bp1 UTSW 2 121270528 missense possibly damaging 0.95
R0648:Trp53bp1 UTSW 2 121235707 missense probably benign 0.20
R0680:Trp53bp1 UTSW 2 121251868 missense probably null 0.13
R0732:Trp53bp1 UTSW 2 121248264 missense probably null 0.96
R0905:Trp53bp1 UTSW 2 121204318 splice site probably benign
R1377:Trp53bp1 UTSW 2 121270642 missense probably damaging 1.00
R1415:Trp53bp1 UTSW 2 121236184 missense probably damaging 1.00
R1725:Trp53bp1 UTSW 2 121252000 missense possibly damaging 0.46
R1971:Trp53bp1 UTSW 2 121205036 missense probably damaging 1.00
R2045:Trp53bp1 UTSW 2 121204483 missense probably benign
R2143:Trp53bp1 UTSW 2 121216064 missense probably benign 0.00
R2282:Trp53bp1 UTSW 2 121270273 nonsense probably null
R2296:Trp53bp1 UTSW 2 121209247 missense possibly damaging 0.96
R3106:Trp53bp1 UTSW 2 121236652 missense probably damaging 1.00
R3792:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3793:Trp53bp1 UTSW 2 121200329 missense probably damaging 1.00
R3946:Trp53bp1 UTSW 2 121228626 missense probably damaging 0.99
R4001:Trp53bp1 UTSW 2 121205085 missense probably damaging 1.00
R4327:Trp53bp1 UTSW 2 121256650 missense probably damaging 1.00
R4585:Trp53bp1 UTSW 2 121207951 missense probably damaging 1.00
R4630:Trp53bp1 UTSW 2 121207887 missense probably damaging 1.00
R4744:Trp53bp1 UTSW 2 121211313 missense probably damaging 1.00
R4751:Trp53bp1 UTSW 2 121227809 missense probably damaging 1.00
R4754:Trp53bp1 UTSW 2 121207879 missense probably damaging 1.00
R4755:Trp53bp1 UTSW 2 121228606 nonsense probably null
R4850:Trp53bp1 UTSW 2 121205113 critical splice acceptor site probably null
R4870:Trp53bp1 UTSW 2 121256641 missense probably damaging 1.00
R4879:Trp53bp1 UTSW 2 121202603 missense probably damaging 0.99
R4924:Trp53bp1 UTSW 2 121221220 nonsense probably null
R4962:Trp53bp1 UTSW 2 121270546 missense probably benign 0.12
R5019:Trp53bp1 UTSW 2 121270319 splice site probably null
R5111:Trp53bp1 UTSW 2 121211387 missense probably damaging 0.99
R5149:Trp53bp1 UTSW 2 121216117 missense probably benign 0.00
R5252:Trp53bp1 UTSW 2 121243983 missense probably benign 0.40
R5533:Trp53bp1 UTSW 2 121207746 missense probably damaging 1.00
R5642:Trp53bp1 UTSW 2 121236662 missense probably benign 0.00
R5773:Trp53bp1 UTSW 2 121243914 missense probably damaging 1.00
R5819:Trp53bp1 UTSW 2 121208392 nonsense probably null
R5886:Trp53bp1 UTSW 2 121205021 missense probably damaging 1.00
R5908:Trp53bp1 UTSW 2 121236823 missense probably benign 0.06
R6012:Trp53bp1 UTSW 2 121256602 missense probably benign 0.07
R6351:Trp53bp1 UTSW 2 121269945 missense probably damaging 1.00
R6406:Trp53bp1 UTSW 2 121270612 missense probably damaging 0.99
R6575:Trp53bp1 UTSW 2 121228603 missense probably damaging 1.00
R6619:Trp53bp1 UTSW 2 121247499 critical splice donor site probably null
R6626:Trp53bp1 UTSW 2 121207803 missense probably damaging 1.00
R6754:Trp53bp1 UTSW 2 121270576 missense possibly damaging 0.83
R6765:Trp53bp1 UTSW 2 121209309 missense probably damaging 1.00
R6806:Trp53bp1 UTSW 2 121228666 missense probably damaging 0.99
R6860:Trp53bp1 UTSW 2 121199113 missense probably damaging 1.00
R6991:Trp53bp1 UTSW 2 121208040 missense probably damaging 1.00
R7339:Trp53bp1 UTSW 2 121236469 missense probably benign 0.00
R7357:Trp53bp1 UTSW 2 121211300 missense probably damaging 1.00
R7477:Trp53bp1 UTSW 2 121236346 missense probably benign 0.34
R7577:Trp53bp1 UTSW 2 121236638 missense possibly damaging 0.65
R7643:Trp53bp1 UTSW 2 121247814 intron probably null
R7728:Trp53bp1 UTSW 2 121207899 missense probably damaging 1.00
R7806:Trp53bp1 UTSW 2 121205061 missense probably damaging 0.99
RF046:Trp53bp1 UTSW 2 121216001 frame shift probably null
Z1088:Trp53bp1 UTSW 2 121253645 missense probably benign 0.04
Z1177:Trp53bp1 UTSW 2 121244060 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CACTGGAGACTATAGAAGCCTG -3'
(R):5'- AGGACTCCCTTTGCAGAGTTG -3'

Sequencing Primer
(F):5'- AACCTACCCTTTTTGAAGGTGGGAC -3'
(R):5'- AGTTGTTAGATATGATGGGCCATAC -3'
Posted On2019-09-13