Incidental Mutation 'R7278:1110002E22Rik'
ID 571529
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R7278 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138065476 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 142 (L142P)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: L142P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: L142P

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,291,126 R996S possibly damaging Het
Abcb6 A G 1: 75,174,373 F558L possibly damaging Het
Acp7 T A 7: 28,630,882 D2V unknown Het
Acvr1c T C 2: 58,284,936 D280G probably damaging Het
Atp8a1 A G 5: 67,624,037 S1124P Het
B4galnt1 A T 10: 127,167,788 T207S probably benign Het
C2cd4d C A 3: 94,364,138 T237N probably benign Het
C8b T C 4: 104,780,627 C99R probably damaging Het
Ccnk C A 12: 108,193,705 Q149K possibly damaging Het
Chfr A G 5: 110,140,360 D47G probably benign Het
Chid1 A T 7: 141,529,488 probably null Het
Cmya5 T A 13: 93,095,700 E960V probably damaging Het
Col18a1 A G 10: 77,096,284 S112P unknown Het
Cps1 G A 1: 67,170,921 V637I probably damaging Het
Crispld1 A G 1: 17,752,878 T390A probably benign Het
Cyp2c54 A T 19: 40,070,253 L245* probably null Het
Ddr2 G T 1: 169,984,961 T654K probably damaging Het
Dnah10 T C 5: 124,791,791 probably null Het
Elavl4 C T 4: 110,211,425 probably null Het
Emilin1 T C 5: 30,920,660 V921A probably benign Het
Evpl T A 11: 116,223,113 E1250D probably damaging Het
Fam228a C T 12: 4,732,790 G101E probably benign Het
Fam92b T A 8: 120,168,603 T187S possibly damaging Het
Gemin4 T C 11: 76,212,106 T610A probably damaging Het
Glis1 T C 4: 107,435,683 M1T probably null Het
Gm14399 C T 2: 175,130,459 probably benign Het
Gorasp2 C T 2: 70,679,505 T170I probably damaging Het
Gpr37 A G 6: 25,669,342 V501A possibly damaging Het
Grik4 T A 9: 42,622,060 Q388L probably benign Het
Hspg2 T A 4: 137,551,125 D3035E probably damaging Het
Htr4 A T 18: 62,412,176 N11Y probably benign Het
Itgb2l A G 16: 96,429,043 S356P probably damaging Het
Klk1b22 A G 7: 44,114,749 N34D probably benign Het
Lmcd1 A G 6: 112,310,539 D62G possibly damaging Het
Lrp2 C T 2: 69,486,352 G2095E probably damaging Het
Macf1 T A 4: 123,440,743 E4407V possibly damaging Het
Mcm5 T C 8: 75,124,859 F631L probably benign Het
Mov10l1 A G 15: 88,993,868 S170G probably benign Het
Muc5b A T 7: 141,857,502 D1395V unknown Het
Muc6 G A 7: 141,640,575 T1395M probably benign Het
Myh15 A G 16: 49,091,105 D300G probably damaging Het
Nat6 T C 9: 107,583,299 L131P probably damaging Het
Ndst4 A G 3: 125,438,303 T174A probably benign Het
Nek5 T A 8: 22,090,484 N406I probably benign Het
Nr2c2 G A 6: 92,159,378 V400I probably damaging Het
Olfr364-ps1 G T 2: 37,147,009 V266L probably benign Het
Olfr365 T C 2: 37,202,080 Y280H probably damaging Het
Olfr449 G A 6: 42,834,396 probably null Het
Olfr554 T C 7: 102,640,983 S246P probably damaging Het
Olfr612 A T 7: 103,538,728 Y169N probably benign Het
Olfr787 T A 10: 129,462,751 I25N probably damaging Het
Parn T C 16: 13,626,063 probably null Het
Pfkl T C 10: 77,992,023 T468A probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Plce1 T C 19: 38,779,896 I2205T possibly damaging Het
Prss16 A T 13: 22,003,147 N442K probably damaging Het
Pus7 A G 5: 23,752,344 S370P probably damaging Het
Ripk3 G T 14: 55,787,284 Y210* probably null Het
Rps6ka2 C A 17: 7,271,635 F317L probably damaging Het
Slc13a3 G A 2: 165,445,528 R169W possibly damaging Het
Slc6a21 T A 7: 45,282,480 I256N possibly damaging Het
Slc6a9 G A 4: 117,868,106 R589Q probably benign Het
Slc8a2 T C 7: 16,141,152 S442P probably damaging Het
Snupn T A 9: 56,982,744 M283K probably damaging Het
Steap3 A T 1: 120,234,357 M395K probably damaging Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Tlr1 A G 5: 64,926,772 V154A probably benign Het
Tmem131 A G 1: 36,796,301 S1580P probably damaging Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Trav14d-3-dv8 G A 14: 53,078,761 R26H probably benign Het
Trp53 C T 11: 69,591,255 L365F probably benign Het
Trp53bp1 A T 2: 121,199,035 I1838N probably damaging Het
Ugt1a5 A T 1: 88,166,886 K279* probably null Het
Unc80 A G 1: 66,552,209 E1141G possibly damaging Het
Vti1b T C 12: 79,166,379 D49G probably benign Het
Wnt10a A T 1: 74,793,482 H78L possibly damaging Het
Zfp869 G A 8: 69,706,478 H482Y probably damaging Het
Zfyve1 A G 12: 83,551,540 V638A probably damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCAACTGGACTGGACAG -3'
(R):5'- CACACGTCTCCACATACTTGG -3'

Sequencing Primer
(F):5'- CAACTGGACTGGACAGCTCAG -3'
(R):5'- CCACATACTTGGCTTCAGGC -3'
Posted On 2019-09-13